Full text of "USPTO Patents Application 10687850"

See other formats

WORLD INTELLECTUAL FROPERTY ORGANIZATION
bitematioDal Bureau

PCT

INTERNATIONAL APPUCATION PUBUSHED UNDER THE PATENT COOPERATION.TOEATY (PCT)

(51) Internatloiial Patent Classlficatloii ^ :
C12Q 1/68, GOIN 27/30

(11) International Publication Numben WO 99/57317

(43) Intmational Publication Date: 1 1 November 1999 (Iia L99)

(21) International Application Number: PCrr/US99/10104

(22) International FlUng Date: 6 May 1999 (06.05.99)

(30) Priority Data:
60/084,652
60/084,509
09/135.183

6 May 1998 (06.05.98) US
6 May 1998 (06.05.98) US
17 August 1998 (17.08.98) US

(71) AppUcant: CLINICAL MICRO SENSORS, INC. (US/USJ;

101 Waverly Drive, Pasadena. CA 91 105 (US).

(72) Inventors: BAMDAD, Cynthia; IQl Waverly Drive, Pasadena,

CA 91105 (US). YU, Changjun; 400 Raymondale Drive
#32, Pasadena. CA 91030 (US).

(74) Agents: SILVA, Robin. M. et al.; Flchr, Hohbach, Test,
Albritton & Hert)ert LLP, Suite 3400, 4 Embaicadwo
Center. San Francisco, CA 94111-4187 (US).

(81) De^gnated States: AL, AM. At. AU. AZ, BA. BB. BG. BR.
BY. CA, CM, CN. CU, CZ, DE, DK. EE. ES. FI. GB, GD.
GB, GH, GM, HR, HU, ID. IL, IN. IS. JP. KB, KG, KP.
KR, ICZ. LC, LK, LR. LS. LT, LU, LV, MD, MO, MK,
MN. MW, MX. NO, NZ, PL. PT. RO. RU, SD. SE. SO. SI,
SK, SL, TJ, TM, TR, TT, UA, UG, UZ, VN, YU, ZA, ZW,
ARIPO patent (GH, GM, KE, LS, MW, SD, SL. SZ, UG,
ZW). Eurasian patent (AM. AZ. BY. KG, KZ, MD. RU, TJ.
TM), European patent (AT, BE. CH. CY, DE, DK, ES. FI,
FR. GB. GR, IE. IT. LU. MC. NL. PT, SE). OAPI patent
(BF, BJ, CP, CG, a, CM, GA, GN, GW. ML, MR, NE,
SN, TD, TG).

Published

With international search report.

Before the expiration of the time limit for amending tfte
clams and to be republished in the event of the recent of
amendments.

(54) Title: ELECTRONIC METHODS FOR THE DEIBCTION OF ANALYTES UTILIZING MONOLAYERS
(57) Abstract

The present invention relates to the use of self-assembled monolayers with mixtures of conductive oligomers and insulators to detect
target analytes.

FOR THE PURPOSES OF INPORMATION ONLY
Codes used to Identify States party to the PCT on the fionl pages of pamphlets pubOshing international applications under the PCT.

AL ARxnia

AM Aimenia

AT Austris

AU Australia

AZ Azobiijaa

BA Bosnia and Heizegovina

BB Baitndoe

BB Bclghmi

BF Buflcinalto

BG Bulgiria

BJ Benin

BR BrazO

BY Behnis

CA Canada

Cf CtxOtA African Rqniblie

CC Congo

CH Switttriand

CI Cfiled*1v(^

CM Camenioa

CN China

CU Cnba

CZ CEediRqmbHc

BE Cerauny
BK

I^Rttoa
Gabon

United Kingdtam

Geoi;gia

Ghana

Guinea

Greoco

l«Mlm-jl

MBiaDB
brad

Italy

Japan

Kenya

Kytgyzstan

I>Bn»ocfatSc Ptaopk't

Reiniblic of Korea

RcpnUie of Korea

Saiat Lucia

Sri
LSscria

LS
LT
LU
LV
MC
MD
MG
MK

Lesotho
Uthoania
Laxemboug
Latvia

RepobBcofMoUova

The former Yiigosfanr
Reimbfiecr Macedonia
MaU

Monsolia

Mexioo

Norway

NewZcataad

PiDland

pQitngd

Romania

Sodan

Slofvenia

Slovakia

Senegal

Swanhmd

Chad

iiuaiueiiism

ttinidadandTob^ .

Ukraine

Uganda

United Statea of Aaeiiea

UtbeUstan

Viet Nam

Yngodairia

ZimbdiwB

wo 99/57317

PCT/US99/10ia4

ELECTRONIC METHODS FOR THE DETECTION OF ANALYTES
UTILIZING MONOLAYERS

This application is a continuing application of U.S.S.N.s 60/084,652, filed May 6. .199i3; 60/084.509, filed
May 6. 1998, and 09/135,183. filed August 17. 1998.

FIELD OF THE INVENTION

The present Invention relates to the use of self-assembled monolayers with mixtures of conductive
oligomers and insulators to detect target analytes. '

BACKGROUND OF THE INVENTION

There are a number of assays and sensors for the detection of the presence and/or concentration of
specific substances in fluids and gases. Many of these rely on specific ligand/antiligand reactions as
0)e nriechanism of detection. That is, pairs of substances (Le. the binding pairs or ligand/antiligands)
are known to Irind to each other, while binding little or not at all to other substances. This has been ttie
foois of a number of techniques that utilize tiiese binding pairs for the detection of the complexes.
These generally are done by labeling one component of the complex in some way, so as to make the
entire complex detectable, using, for example, radioisotopes, fluorescent and other optically active
molecufes, enzymes, etc.

Other assays rely on electronte signals for detection/ Of particular interest are biosensors. At least
two types of biosensors are known; enzyme-based or metabolic biosensors and binding or bioaffinity
sensors. See for example U.S. Patent No. 4.713,347; 5.192.507; 4.920,047; 3,873,267; and
reli^rences disclosed therein. While some of these known sensors use alteniating current (AC)

"^OmSTSn PCT/US99/10104

techniques, these techniques are generally limited to the detection of differences in bulk (or dielectric)
nnpedance.

The use of setf-assembled monolayers (SAIMs) on surfaces for binding and detection of biological
molecules has recently been explored. See for example WO98C0162: PCT US98/12430; PCT
US98/12082: PCT US99/01705: and U.S. Patent No. 6.620.850: and references cited therein.

Accordingly, It is an object of the invention to provide novel methods and compositions for the
electronic detection of target analytes using self-assembled monolayers.

SUMMARY OF THE INVENTION

in accordance with the objects outlined above, the present invention provides compositions comprising
electrodes comprising a monolayer comprising conducth^e oligomers, and a capture binding Bgand
The composrtion further comprises a recruitment linker that comprises at least one covalently attached
electron transfer moiety, and a solution binding ligand that v«ll bind to a target analyte.

in a further embodiment, the invention provides methods of detecting a target analyte In a test sample

comprising attaching said target analyte to an electrode comprising a monolayer of condu^^
Oligomers via binding to a capture binding Bgand. Recruitment linkers, or signal earners, are directly or
indirectly attached to the target analyte to torn an assay complex. The method further comprises
detecting electron transfer between saw ETM and said electrode.

Kits and apparatus comprising the compositions of the method are also provided.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1 A. IB and 1 C depkrt three preferred embodiments for attaching a target nudel^
s^uencetotheelect^Hla Figure 1Adeplctsatergetsequencei20hybridlzedtoa«^^^^^
I«kedvlaaattad,mentlnterloe.whid,a8outnnedhereinmaybee^ -
dilator. Titeeleclrt«e105con^amonolayerofpassjvatk«agent107.whlchcanc^^^
conductive oligomer (herein depicted as 108) and/or insulators (herein deptete^
preferablyboth. As for all the embodiments depided in the figures, n Is an integer of atl^^^
although as wni be appredated by those in me art the system may not

(lan«zero). although thisisgenerallynotpreferred. The upper Omit ofnwBI depend on the tength- -
ofthetargetsequenceandtherequiredsensitivity.Figure1BdeplctetheuseofaslngIe«^^ -
extender probeliowithafirstportfonlll that wfllhybridizetoafiretportk^

wo 99/57317

PCT/US99/10104

120 and a second portbn that will hybridize to the capture probe 100. Figure 1C depicts the use of
two capture extender probes 110 and 130. The first capture extender probe 110 has a first portion
111 that wll hybridize to a first portion of the target sequence 120 and a second porti^
hybridize to a first portion 102 of the capture probe 100. The second capture extender probe 130 has
5 a first portion 132 that will hybridize to a second portion of the target sequence 120 and a second

portion 131 that will hybridize to a second portion 101 of the capture probe 100. As will be appreciated
by those in the art, while these systems depict nucleic acid targets, these attachment configurations
may be used with non-nucleic acid capture binding ligands; see for example Figure 2C.

10 Figure 2A, 2B, 2C and 2D depict several embodiments of the invention. Figure 2A is directed to the

use of a capture binding ligand 200 attached via an attachment linker 106 to the electrode 105. Target
analyte 210 binds to the capture binding ligand 200, and a solution binding ligarid 22 witii a directiy
attached recruibnent linker 230 with ETMs 135. Figure 2B depicts a similar embodiment using an
indirecUy attached recruitment linker 145 that binds to a second portion 240 of the solution binding

15 ligand 220. Rgure 2C depk:ts tiie use of an anchor ligand 100 (refen-ed to herein as an anchor probe
when the ligand comprises nucleic acid) to bind tiie capture binding ligand 200 comprising a portion
120 tiiat will bind to the anchor probe 100. As will be appreciated by those in the art, any of the Figure
1 embodiments may be used here as well. Figure 2D depicts ttie use of an amplifier pnjbe 145. As
vwll be appreciated by tiiose in tiie art, any of \he Figure 3 amplifier probe configurato'ons may be used

20 here as well.

Rgures 3A. 3B, 3C. 3D, 3E. 3F. 3G and 3H depict some of the embodiments of tiie invention. While .
depfcted for nucleic acids, ttiey can be used in non-nucleic acid embodiments as wen. All of tiie
monolayers depicted herein show the presence of botti conductive oligomers 108 and insulators 107
25 in roughly a 1 :1. ratio, altiiough as discussed herein, a variety of different ratios may be used, or ttie
insulator may be completely absent In addition, as will be appreciated by tiiose in the art, any one of
these structures may be repeated for a particular target sequence; that is/for long target sequences/
. ttiere may be multiple assay complexes fonmed. Additionally, any of tiie electrode-attachment
embodiments of Figure 3 may be used in any of tiiese systems.

Figures 3A, SB and 3D have ttie target sequence 120 containing ttie ETMs 135; as discussed herein,
tiiese may be added enzymaticafly. for example during a PCR reaction using nucleotides modified witti
ETMs, resulti/ig in essentially random incorporation throughout ttie target sequence, or added to tiie
tenmlnus of ttie target sequence. Figure 3C depicts ttie use of two different capture probes 100 and
35 100\ that hybridize to different portions of Hie target sequence 120. As wtil be appreciated by those In
ttie art V\e 5*-3' orientation of ttie two capture probes in ttils embodiment is different

WO 99/57317 PGT/U»9/10104
Figure 3C depicts the use of recruitment linkers (referred to herein as labei probes when nudeic acWs
are used) 145 that hybridize directly to the target sequence 120. Figure 3C shows the use of a label
probe 145. comprising a first portion 14ithat hybridizes to a portion of the target sequence 120, a
second portion 142 comprising ETMs 135.

Figures 3E. 3F and 3G depict systems utilizing label probes 145 that do not hybridize directly to the
target, but rather to amplifier probes 150 that are directly (Figure 3E) or indirectly (Figures 3F and 3G)
hybridized to the target sequence. Figure 3E uBIizes an amplifier probe 150 has a first portion 151 that
hybridizes to the target sequence 120 and at least one second portion 152. i.e. the amplifier sequence
that hybridizes to the first portion 141 ofthe label probe. Figure 3F Is similar, except that a first label
extender probe 160 is used, comprising a first portion 161 that hybridizes to the target sequence 120
andasecondportion162thathybridizestoafirstportion151ofamplrfierprobe150. A second portion
152 of the amplifier probe 150 hybridizes to a first portion 141 of the label probe 140. which also
comprises a recruitment linker 142 comprising ETMs 135. Rgure 3G adds a second label extender
probe 170. with a first portion 171 that hybridizes to a portion ofthe target sequence 120 and a second
portion that hybridizes to a portion of the amplifier probe;

Figure 3H depicts a system tiiat utilizes multiple label probes. The first portion 141 of the label probe
140 can hybridize to all or part of the recruitment linl<er 142.

Fgures 4A and 4B show two competitive type assays .of ttie invention. Figure 4A utilizes U»e.
replacement of a target analyte 210 with a target analyte analog 310 comprising a direcUy atteched
recruitment linker 145. As wBI be appreciated by those In the art. an indirectiy attached i^itment
linker can also be used, as shown in Figure 2B. Figure 4B shows a competitive assay wherein «i6
target analyte 210 and the target analyte analog 31 0 attached to ttie surface compete fof binding of a
solution binding ligand 220 wiW, a directly attached recmitinent linker 145 (again, an indirectiy attedied
recruitment linker can also be used, as shown in Rgure 28). in this case, a k>ss of signal may be seen.

F«urK5A.5B,5C.5Dand5Edepictaddffionalembodimentsofttielnvention. Figure 5A shows a
conforrnation wherein the addition of target altars tt» co^

recruitment linker 145 to be placed near the mondayer surface. Rgure 5B shews tiie u

present Invention in candMate bteadhre agent screening, wherein the addition of a drug candkfaie to

target causes titesdutionbinding ligand to dissodate. causing a toss of s^^ fte
solution binding ligand may be added to another surface and be bound, as is geiierally deplded in
figure 5C for enzymes. Rgure 5C depicts the use of an enzyme to deave a substrate 260 comprising
a recmitment linker 145. causing a toss of signal. The deaved piece may also be added to an
additional electrode, causing an increase in signal. Rgure 5D shows the use of two different capture

wo 99/57317

PCTAJS99/10104

. binding ligands 200; these may also be attached to the electrode using capture extender ligands.
Figure 5E adds an additional "sandwich component* In the fonn of an additional solution binding ligand
250:

5 Figures 6A-6R depict nucleic acid detection systems: Figures 6A and 6B hiave the target sequence 5
containing the ETMs 6; as discussed herein, these may be added enzymatically, for example during a
PCR reaction using nucleotides modified with ETMs» resulting in essentially random incorporation
throughout the target sequence, or added to the tenminus of the target sequence. Figure 6A shows
attachment of a capture probe 10 to the electrode 20 via a linker 15, which as discussed herein can be
10 either a conductive oligomer 25 or an insulator 30. the target sequence 5 contains ETMs 6. Figure 6B
depicts the use of a capture extender probe 1 1 , comprising a first portion 1 2 that hybridizes to a
portion of the target sequence and a second portion 13 that hybridizes to the capture probe 10.

Figure 6C depicts the use of two different capture probes 10 and 10*. that hybridize to different:
1 5 portions of the target sequence 5. As will be appreciated by those in the art the 5*-3' orientation of the
two capture probes in this embodiment is diffierent

Figures 6D to 6H depict the use of label probes 40 that hybridfee directly to the targ^ sequence 5.
Figure 6D shows the use of a label probe 40, comprising a first portion 41 that hybridizes to a pbrtibri

20 of the target sequence 5, a second portion 42 that hybridizes to the capture probe 10 and a

recruitment linker 50 comprising ETMs 6. A similar embodiment is shown in Figure 6E, where the
label probe 40 has an additional recaiitment linker 50. Rgure 6F depicts a label probe 40 comprising
a first portion 41 that hybridizes to a portton of the target sequence 5 and a recruitment linker 50 with
attached ETMs 6. The parentheses highlight that for any particular target sequence 5 nnore than one

25 label probe 40 may be used, with n being an integer of at least 1. Figure 6G depicts the use of the

Figure 6E label probe structures but includes the use of a single capture lender probe 11. with a first
portion 12 that hybridizes to a portion of the target sequence and a second portion 13 that hybridizes
to the capture probe 10. Figure 6H deptots the use of the Rgure 6F label probe structures but utilizes
two capture extender probes 11 and 16. The first capture extender probe 11 has a first portion 12 that

30 hybridizes to a portion ofthe target sequence 5 and a second portion 13*^^

portion 14 of the capture probe 10. The second capture extender probe 16 has a first portion 18 that
hybridizes to a second portion of the target sequence 5 and a second portion 17 that hybridizes to a
second portton 19 of the capture probe 10.

35 Figures 61. 6J and 6K depict systems utilizing label probes 40 that do not hybridize directly to the

target, but rather to ampHfier probes. Thus the amplifier probe 60 has a first portk>n 65 that hybridizes

wo 99/57317

PCT/US99/l6ia4

to the target seiquence 5 and at jeast one second portion 70, i.e, the amplifier sequence, that
hybridizes to the firist portion 41 of the label prot)e.

Figures 6L, 6I\^ and 6N depict systems that utilize a first label extender probe 80. In these
5 embodiments, the label extender probe 80 has a first portion 81 that hybridizes to a portion of the

target sequence 5, and a second portion 82 that hybridizes to the first portion 65 of the amplifier probe

Figure 60 depicts the use of two label extender probes 80 and 90. The first label extender probe 80
10 has a first portion 81 that hybridizes to a portion of the target sequence 5, and a second portion 82 that
hybridizes to a first portion 62 of the amplifier probe 60. The second label extender probe 90 has a
first portion 91 that hybridizes to a second portion of the target sequence 5 and a second portion 92
that hybridizes to a second portion 61 of the amplifier probe 60.

15 Figure 6P depicts a system utilizing a label probe 40 hybridizing to the terminus of a target sequence
5.

Figures 6Q and 6R depict systems that utilizes multiple label probes. The first portion 41 of the label
probe 40 can hybridize to all (Figure 6R) or part (Figure 6Q) of the recmitment linker 50.
20 '

Figure 7 depicts the use of an activated c^rboxylate for ttie addition of a nucleic acid functionalized
Witt) a primary amine to a pre-formed SAM.

Figure 8 ishows a representative hairpin structure. 500 is a target binding sequence. 510 is a loop
2 5 sequence. 520 is a self-complementary region, 530 is substantially complementary to a detection

probe, and 530 Is ttie -sticky end", ttiat is, a portion ttiat does not hybridize to any ottier portion of ttie
probe, ttiat contains ttie ETMs.

Figure 9 depicts the syntiiesis of an adenosine comprising a fenocene linked to ttie ribose.

Figure 10 depi(4s ttie synttiesis of a •branch" point (in ttiis case an adenosine), to allow ttie addition of
ETM polymers^

Figure 11 depicts ttie synttietic scheme of a preferred attachment of an ETM, in ttils case ferrocene, to
35 a nucleoside via ttie phosphate.

Figure 12 depfcts ttie synttietic scheme of ettiylene glycol temiinated conductive oligomers.

wo 99/57317

PCT/US99/10104

Rgure 1 3 depicts the synthesis of an Insulator to the ribose of a. nucleoside for attachment to an
electrode.

Figures 14A, 14B. 14C, 14D. 14E, 14F, 14G. 14H. 141. 14J and 14K depict a number of different
emlxxJiments of the invention; the results are shovwi in Example 7.

Figures 1 5A-1 50 depict depict a number of different compositions of the invention; the results are
shown in Example 7 and 8. Figure 15A depicts I. also referred to as P290. Figure 15B depicts II. also
refenred to as P291 Figure 15C depicts III. also refenred to as Vy31, Figure 15D depicts IV. also
referred to as N6. Figure 15E depicts V. also refen^d to as P292. Figure 51 F depicts II. also referred
to as C23. Figure 15G depicts Vll, also refen-ed to as CIS. Figure 15H depicts VIII. also referred to
asC95. Figure 151 depicts Y63. Figure 1J depicts another compound of the Invention. Figure 15K
depicts Nil. Figure 15L depicts C131. with a phosphoramidite group and a DMT protecting group.
Figure 15M depicts W38, also with a phosphoramidite group and a DMT protecting group. Rgure 15N
depicts the commercially available moiety that enables "branching* to occur, as its incorporation Into a
growing oligonucleotide chain results In addition at both the DMT protected oxygens. Figure 15b
depicts glen, also with a phosphoramidite group and a DMT protecting group, that serves as a non-
nucleic acid linker. Figures 15A to 16G and 15J are shown without the phosphoramidite and .
protecting groups (i.e. DMT) that are readily added.

Figures 16A - 16B depict representative scans from the experiments outlined in Example 7. Unless
othenwise noted, all scans were run at Initial voltage -0.1 1 V. final voltage 0.5 V. with points taken
every 10 mV, amplitude of 0.025, frequency of 10 Hz, a sample perfod of 1 sec. a quiet time of 2 sec.
Rgure 16A has a peak potential of 0.160 V, a peak current of 1 .092 X 10^ A, and a peak A of 7.563 X
lOr^^VA.

Figure 17 depicts the synthetic scheme for a ribose linked ETM, VV38.

Rgures 18A and 18B depicts two phosphate attachments of conductive oBgomers that can be used to
add the conductive oligomers at the 5* position, or any position.

Rgure 19 depicts a schematic of the synthesis of simultaneous incorporation of multiple ETMs into a
nudek: add, gsing a "branch* point nudeosWe.

wo 99/57317 PCTAJS99/10104

Figure 20 depicts a schematic of an alternate method of adding large numbers of ETMs
simultaneously to a nucleic acid using a "branch" point phosphoramidite, as is known in the art As win
be appreciated by those in the art. each end point can contain any number of ETMs.

Figures 21 A. 21 B, 21 C, 21 D and 21 E depict different possible configurations of label probes and
attachments of ETMs. In Figures 21A-C, the recruitment linker is nucleic acid; in Figures 21 D and E,
Is is not A = nucleoside replacement; B = attachment to a base; C = attachment to a vtose; D =
attachment to a phosphate; E = metaltocene polymer (although as described herein, this can be a
polymer of other ETMs as well), attach^ to a base, ribose or phosphate (or other backbone analogs);
F = dendrimer structure, attached via a base, ribose or phosphate (or other backbone analogs); G =
attachment via a "branching" stnjcture, through base, ribose or phosphate (or other backbone
analogs); H = attachment of metallocene (or other ETM) polymers; I = attachment via a dendrimer
structure; J - attachment using standard linkers.

Figures 22A and 22B depict some of the sequences used in the Examples.

DETAILED DESCRIPTION OF THE INVENTION

The pr^ent irivention is directed to the electronic detection of analytes. Previous wori^ described in
PCT US97/2d014, is directed to the detection of nudefc adds, and utilizes nudek: acids covalently
attached to electrodes using conductive oligomers, l.e. chemicaj "wires*. Upon formatton of double
stranded nucleic acids containing electron transfer moieties (ETMs), electron transfer can prt)ceed
through the stacked n-orii>ilals of the heterocydid bases to the electrode, thus enabling electronte
detection of target nucleic adds. In the absence of the stacked TW)rbitals, l.e. when the target strand
is not present, electron transfer is negligible, thus altowing the use of the system as an assay. This
previous woric also reported on the use of self-assembled monolayers (SAMs) to electronically shield
the electrodes from solution components and significantly decrease the amount of non-spedfic binding
to the electrodes.

The present Inventfon Is directed to the discovery that present or absence of ETMs can be directly
detected on a surfece of a mondayer if the monolayer comprises conductive oHgomers, and preferably
mbdures of conductive ongomers and insulators. Thus, Ibr example, when the target analyte is a
nuclefc add, the dectrons frorn the ETI\/ls n€«d

generate a signal Instead, the presence of ETMs on the surface of a SAM, that comprises conductive
olig|omers, can be directly deteded. Thus, upon binding of a terget analyte to a bniding spedes on the
surface, a recruitment Hnker comprising an. ETM is brought to the surface, and detecbon of the ETM
can proceed. Thus, the role of the target analyte and binding spedes is to provWe spedficity for a

wo 99/57317 PCT/US99/10104

recruitment of ETMs to the surfiace, where they can be detected using the electrode. Without being
bound by theory, one possible nnechanisnn is that the role of the SAM comprising the conductive
oligomers Is to "raise" the electronic surface of the electrode, while still providing the benefits of
shielding the electrode from solution components and reducing the anriount of non-specific binding to
5 the electrodes.

The invention can be generally described as follows, with a number of possible embodiments depicted
In the Rgures. In a prefen^ed embodiment, as depicted in Figure 2. an electrode comprising a self-
assembled monolayer (SAM) of conductive oligomers, and preferably a mixture of conductive

10 ollgonf)ers and Insulators, and a covalently attached target analyte binding ligand (frequently referred to
herein as a "capture binding ligand") is made. The target analyte is added, which binds to the support-
bound binding ligand. A solution binding ligand is added, which may be the same or different from the
first binding ligand, which can also bind to the target analyte. forming a "sandwich" of sorts. The
isolutioh binding ligand either comprises a recruitment linker containing ETMs, or comprises a portion

1 5 that will either directly or indirectly bind a recruitment linker containing the ETMs. This "recruitment" of
ETMs to the surface of the monolayer allows electronic detection via electron transfer between the
ETM and the electrode. In the absence of the target analyte. the recrultnnent linker is either washed
. away or not in sufficient proximity to the surface to allow detection.

20 In an altemate preferred embodiment, as depicted in Figure 4, a competitive binding type assay is run.
In this embodiment, the target analyte in the sample is replaced by a target analyte analog as is
described below and generally known in the art The analog comprises a directly or indirectly attached
recruitment linker comprising at least one ETM. The binding of the analog to the capture binding
ligand recruits the ETM to the surtece and altows detection based on electron transfer between the

25 ETM and the electrode.

\h an additkHial preferred embodiment, as depicted in Figure 4B, a competitive assay wherein the
target analyte and a target analyte analog attached to the surface compete for bi solution
Unding ligand with a directly or ind^ecUy attached recruitment linker. In this case, a loss oiF signal may
30 beseen.

Accordingly, the present invention provides methods and compositions useful in the detection of target
analytes. By "target analyte" or "analyte" or grammatical equivalents herein is n^nt any molecule or
confound to be detected and ttiat can bind to a binding species, defined below. Suitable analytes
3 5 include, but not limited to, small chemical molecules such as environmental or dinical chemical or
pollutant or bfomolecute, including, but not linuted to. pestiddes, insecticides, toxins, tiierapeutic and
abused drugs, honnones, antibiotics, antibodies, organic materials, eto. Suitable biomolecules

wo 99/57317 PCTAJS99/10104

include, but are not limited to. proteins (including enzymes, immunoglobulins and glycoproteins),
nucleic adds. Rpids, lectins, carbohydrates, hormones, whole cells (bidudlng procaryotic (such as
pathogenic bacteria) and eucaiyob'c cells, induding mammafian tumor cells), viruses, spores, etc.
Particularly preferred analytes are proteins induding enzymes; drugs, cells; antibodies; antigens;
cellular membrane antigens and receptors (neural, homional, nutrient, and ceil sur^ receptors) or
their ligands.

By "proteins" or grammatical equivalents herein is meant proteins, oligopeptides and peptides, and
analogs, induding proteins containing non-naturally occuring amino adds and amino acid analogs,
and peptidomimeticstnictures.

As win be appreciated by those in the art, a large number of analytes nray be detected using the
present methods; basically, any target analyte for which a binding Bgand. described below, may be
made may be deteded using the methods of the invention.

By "nucleic acid" or "oligonucleotide" or grammatical equivalents herein means at least two
nucleotides covaiently linked together. A nucleic add of the present invention will generally contain
phosphodiester bonds, although in some cases, as outlined below, nucleic acid analogs are induded
that may have alternate backbones, comprising, for example, phosphoramjde (Beaucage et al..
Tetrahedron 49(10):1925 (1993) and references therein; Letsinger, J. Org. Chem. 35:3800 (1970);
Sprinzl et al.. Eur. J. Blochem. 81:579 (1977); Letsinger et al.. Nud. Adds Res. 14:3487 (1986); Sawai
et al. Chem. Lett 805 (1984). Letsinger ^ al.. J. Am. Chem. Soc. 110:4470 (1988); and Pauwels et aL.
Chemica Scripta 26:141 9il986)), phosphorothk)ate (Mag et aL. Nucleic Adds Res. 19:1437 (1991);
and U.S. Patent No. 5.644,048), phosphorodithioate (Briu et at, J. Am. Chem. Soc. 1 1 1 :2321 (1989),
O-methylphophoroamidrte linkages (see Eckstein. Oligonucleotides and Anatogues: A Practical
Approach, Oxford University Press), and peptide nuclefc acid baddxHies and Onkages (see ^holm, J.
Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. InL Ed. EngL 31:1008 (1992); Nielsen. Nature,
365:566 (1993); Carisson et al.. Nature 380:207 (1996). all of whidi are incorporated by reference).
Other analog nudeic adds include those with positive backbones (Denpcy et al., Proc. Natl. Acad. Sd.
USA 92.-6097 (1995); non-ionte backbones (U.S. Patent Nos. 5.386,023, 5,637,684. 5.602,240.
5.216.141 and 4.469.863; KledrowshI et al.. Angew. Chem. Intl. Ed. English 30:423 (1991); Letsinger
et aL, j: Am. Chem. Soa 110:4470 (1988); Utslnger et aL, Nudeoskle & Nucleotide 13:1597 (1994);
Chapters 2 and 3, ASC Symposium Series 580. ^Jarbohydrate Modifications in Antlsehse Research*.
Ed. Y.S. Sanghui and P. Dan Cool? Mesmaekeret al.. Biobrganic& Medkdhal Chem. LetL 4:395
(1994): Jeffis et al.. J. Bwrtnlecular NMR 34;17 (1994); Tetrahedron LetL 37:743 (1996)) and non-
n-bose backbones, induding those described in U.S. Patent Nos. 5.235.033 and 5.034.506, and
Chapters 6 and 7. ASC Symposium Series 580. ^Carbohydrate Modiftealions in Antisense Research'.

wo 99/57317 PCT/US99/10104

Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also
included within the definition of nucleic adds (see Jenkins et al., Chem. Soa Rev. (1 995) pp169-
176). Several nucleic acid analogs are described in Rawls, C & E News June 2, 1997 page 35. All of
these refierences are hereby expressly incorporated by reference. These modifications of the ribose-
5 phosphate backbone may t>e done to facilitate the addition of ETMs, or to Increase the stability and
half<-lile of such molecules in physblogical environments.

As will be appreciated by those in the art, all of these nucleic add analogs may find use in the present
invention. In addition, mixtures of naturally occurring nucleic acids and anatogs can be made; for
1 0 example, at the site of conductive oligomer or ETM attachment, an analog structure may be used.
Alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occuring nudeic
acids and analogs may be made.

Particulariy prefenred are peptkie nucleic acids (PNA) which includes peptide nudeic acid analogs.
15 These backbones are substantially non-ionic under neutral conditions, in contrast to the highly
charged phosphodiester backbone of naturally occum'ng nucleic acids. This results In two
advantages. First, the PNA backbone exhibits Improved hybridization kinetics. PNAs have larger
changes in the melting temperature (Tm) for mismatched versus perfecUy matched basepairs. DNA
and RNA typically exhibit a 2-4**C drop in Tm for an intemal mismatch. Witti the non-ionic PNA

2 0 backbone, the drop is doser to 7-9*^0. Similariy, due to their non-ionic nature, hybridization of the

bases attached to these backbones is relatively insensitive to salt concentration. This is particularly
advantageous in the systems of the present invention, as a reduced salt hybridization solution has a
lower Faradak: current than a physiological salt solution (in the range of 1 50 mM).

25 The nucleic adds may be single stranded or double stranded, as spedfied, or contain portfons of botti
double stranded or single stranded sequence. The nudefc add may be DNA, both genomic and
cDNA, RNA or a hybrid, where the nudeic add contains any combination of deoxyribo^ and vb6:
nudeoBdes, and any combifiaSon of bases Jndudlnguradl, aden^^^^ .
inosine, xattianine hypoxathanine, isdcytbsine, Isoguanlne, etc. A preferred embodiment utilizes

3 0 Isocytosine and isoguanine in nucleic adds designed to be complenrientary to other probes, rather

than target sequences, as this reduce non-spedfic hybridization, as Is gene^^^
Patent No. 5.681.702. As used herein, the tenti 'nudeoskJe" includes nudeotides as well as
nudeoside and nucleotide analogs, and nrxxlified nucleosides such as amino modified nudeosides. In
addition, "nudeoside" Indudes non-nalurally occuring analog structures. Thus for example the
3 5 Individual units of a peptide nudeic add, each containing a base, are referred to herein as a
nudeoside.

wo 99/57317

In one eir^iment, nucleic add target analytes are not^preferred.

PCT/US99/10104

As will be appreciated by those in the art a targe number of analytes may be detected using the
present methods; basically, any target analyte for which a binding ligand, described bekw, may be
nrade may be detected using the methods of the invention.

Accordingly, the present invention provides methods and compositions useful in the detection of target
analytes. In a preferred embodiment, the compositions comprise an electrode comprising a
monolayer. By -electrode" herein Is meant a composition, which, when connected to an electronic
device, is able to sense a current or charge and convert it to a signal. Thus, an electrode is an ETM
as described herein. Preferred electodes are known in the art and include, b^^
certain metals and their oxides. Including gold; platinum; palladium; silicon; aluminum; metal oxide
electrodes including platinum oxide, titanium oxide, tin oxide, indium tin oxide, palladium oxide. siTicon
oxide, aluminum oxide, molybdenum oxide (Mo^Oe). tungsten oxide (WO,) and ruthenium oxid^; and
cartwn (including glassy carbon electrodes, graphite and carbon paste). Preferred electrodes indude
gold, silicon, carbon and metal oxide electrodes, with gold being particularty preferred.

the electrodes described herein are depicted as a flat surface, which is only one of the possible
confbnrnationsoftheelectrodeandisfbrschernatlcpurposesonly. The conformation of the electrode
win vary with the detection method used. For example, flat planar electrodes may be preferred for
optical defection methods, or when arrays of nudeic adds are made, thus requirmg addressable
locations for both synthesis and detedlon. Alternatively, for single probe analysis, the electrode may
be in the form of a tube, with the SAMs comprising oondiictfve oligpmeis and nucleic adds bound to
the inner surface. This allows a maximum of surfece area containing the nudeic adds to be exposed
to a small volunw of sample.

The electrode comprises a monolayer, comprising conductive oHgomers. By "monolayer" or "sel^
^mbted monolayer* or "SAM- herein is meant a relatively oidered assembly of molecules
spontaneously djemisorbed on a suriiace, in whidt the molecules are oriented approximately parallel
to each other and roughly perpendidilar to the surface. Eadi of the molecules includes a luncfional
group that adheres to the surface, and ? porton that Ir^^
monolayer to liDrm the relaHveV ortered

monolayer, that is. where at least two different molecule? mate up the.

comprise conductive oligomers alone, or a mixture of cotidudlve ^

herein, the use of a monolayer reduces the amount of non-spedffe binding of btomoiecules to the

surface, and. in the case of nucleic acids, increases the efficiency of djgonudeotWe hybridization as a

result of the distance of the oligonudeotide from the eledrode. Thus, a monolayer faditates the

wo 99/57317 PCTAJS99A0104
maintenance of the target analyte away from the electrode surface* In addition, a monolayer serves to
keep charge carriers away from the surface of the eiecfrode. Thus, this layer helps to prevent .
electrical contact between the electrodes and the ETMs. or between the electrode and charged
species within the solvent Such contact can result in a direct "short cfrcuir or an indirect short circuit
via charged species which may be present in the sample. Accordingly, the monolayer is preferably
tightly packed in a uniform layer on the electrode surface, such that a minimum of "holes" exist The
monolayer thus serves as a physical bamer to block solvent accesibiFity to the e^

In a preferred embodiment, the monolayer comprises conductive oligomers. By "conductive oligomer"
herein is meant a substantially conducting oligomer, preferably linear, some embodiments of which are
referred to in the literature as ''molecular wires". By "substantially conducting" herein is meant that the
oBgorror is capable of transfering electrons at 100 Hz. Generally, the conductive oligomer has
substantially overtapping n-orbitals, i.e. conjugated n-orbitals, as between the monomeric units of the
conductive oligomer, although the conductive oligomer may also contain one or more sigma (o) bonds.
Additionally, a conductive oligomer may be defined functfonally by its ability to inject or receive
electrons into or from an associated ETM. Furthemnore; the conductive oligomer is tnore conductive
than the insulators as defined herein. Additionally, the conductive oligomers of the invention are to be
distinguished from electrosK^tive polymers, that themselves nray donate or accept electridns. .

In a preferred embodiment, the conductive oligomers have a conductivity, S, of from between about
10® to about 10* Q-'cm \ with from about 10"^ to about 10^ Q-'cm'^ being prefen^, with these S values
being calculated for molecules ranging from about 20A to about 200A. As di^cribed below, insulators
have a conductivi^ S of about 10*^ Q 'cm-^ or lower, with less than about 10* Q-^cm*^ being prefen^d.
See generally Gardner et al., Sensors and Actuators A 51 (1 995) 57-66, Incorporated herein by
reference.

Desired characteristics of a conductive oligonnter include high conductivity, sufficient solubility in
organic solvents and/or water for synthesis and use of the compbsittehs of the invention, and
preferably chemical resistance to reactions that occur i) during nucleic add synthesis (such that
nucleosWes containing the conductive oligonTers may be added to a nudeic add synthesizer during
the synthesis of the compositions of the invention), li) during the attachnrtent of the conductive oligomer
to an electrode, or iii) during hybridizatfon assays. In addition, conductive digomers that will promote
the fonrmtfon of 5elf^ssembled nK>nolayers are preferred. -

The oligomers of the invention comprise at least two monomeric siibunrts, as described herein. As is .
descnl>ed more fully below, ofigomers indude homo- and hetero-oligomers, and indude polymers.

wo 99/57317 PCTAJS99/10104

In a preferred embodiment the conductive oligomer has (he structure depicted in Structure 1:

Structure 1

As will be understood by those in the art, all of the structures depicted herein may have additional
atoms or structures; i.e. the conductive oligomer of Structure 1 may be attached to ETMs, such as
electrodes, transition metal complexes, organic ETMs. and metallocenes. and to capture binding
ligands such as nucleic acids, or to several of ttiese. Unless othenvise noted, the conductive oligomers
10 depicted herein will be attached at the left side to an electrode; that is, as depicted in Structure 1, the
left "T* is corinected to the electrode as described herein. If the conductive oligomer Is to be attached
to a binding ligand, the right 'Y*, if present is attached to the capture binding ligand, either directly or
through the use of a linkerv as is described herein.

15 In this embodiment Y is an aromatic group, n is an integer from 1 to 50, g is either 1 or zero, e is an
integer from zero to 10, and m is zero or 1. When g is 1. B-D is a conjugated bond, preferably
selected from acetylene, alkene, substituted aikene. amide, azo, -C=N- {including -N=C-, -CR=N- and
-N-CR-), -Si=Si-, and -Si=C- (including -OSK -Si=CR- and -CR=Si-). When g is zero, e is preferably
1, D Is preferably carbonyl, or a heteroatom moiety, wherein the heteroatom is selected from oxygen,

20 sulfur, nitrogen, silkx>n or phosphorus. Thus, suitable heteroatom nrK>leties include, but are not limited
to. -NH and -NR. wherein R is as defined herein; substituted sulfur; sutfbnyl (-SO2-) sulfoxide (-SO-);
phosphine oxide {-PO- and -RPO-); and thtophosphine {-PS- and -RPS-). However, when the
conducive oligomer is to be attached to a gold electrode, as outlined below, sulfur derivatives are not
preferred. ^:;

By "arornatfc group" or grammatical equivalents herein is meant an aromatic monocyclic or polycydic
hydrocarbon moiety generally containing 5 to 14 carbon atoms (although larger polycydic rings
structures may be made) and any cartx)cylic ketone or thioketone derivative thereof, wherein the
cartx)n atom with the free valence is a member of an aromatic ring. Aromatic groups include arylene

3 0 groups and aromatic groups wtth nriore tfian two atoms removed. For the purposes of this application
arorratic Includes heterocycle. "Heterocyde" or 'heteroaryr means an aromatic group wherein 1 to 5
of ttie indteated carbon atoms are replaced by a heteroatom chosen from nitrogen, oxygen, sulfur,
phosphorus, boron and sOicon wherein ttie atom w»h the firee valence Is a member of an aromatic ring;
and any heterocycfic ketone and thioketone derivative thereof. Thus, heterocyde indudes tiiienyl,

35 furyi. pyrrdyl, pyrimidlnyl. oxaJyl, tad^^

wo 99/57317 PCT/US99/10104

Importantly, the Y aromatic groups of the conductive oligomer may be different, Le. the conductive
oligomer may be a heterooligbmer. That is, a conductive oligomer may comprise a oligomer of a
single type of Y groups, or of multiple types of Y groups.

5 The aromatic group may be substituted with a substitution group, generally depicted herein as R. R
groups may t>e added as necessary to affect the packing of ttie conductive oligomers, Le. R groups
rhay be used to alter the association of tiie oligomers in the monolayer. R groups may also be added
to 1 ) alter the solubility of the oligomer or of compositions containing tiie oligomers; 2) alter the
conjugation or electrochemical potential of tiie system; and 3) alter Uie charge or characteristics at the
10 surface of the monolayer.

In a preferred embodiment, when the conductive oligomer is greater ttian three subunits, R groups are
preferred to increase solubility when solution syntiiesis is done. However, the R groups, and tiieir
positions, are chosen to minimally effect the packing of the conductive oligomers on a surface,
15 particulariy within a monolayer, as described betow. In gerieral, only small R groups are used witiiin
the monolayer, with larger R groups generally above the sur^e of the nnonolayer. Thus for example
the attachment of methyl gn?ups to the portion of the conductive oligomer witiiin tiie monolayer to .
increase solubility is preferred, witii attachment of longer alkoxy groups, for example, C3 to CIO, is
preferably done above the monolayer surfece. In general, for tiie systems described herein, ttiis

2 0 generally means ttiat attachment of sterically signifrcant R groups is not done on any of the first two or

three oligomer subunits, depending on tiie average lengtii of Uie molecules making up tiie monolayer.

Suitable R groups include, but are not limited to, hydrogen, alkyi, alcohol, aromatic, amino, amido,
nitro, ethers, esters, aldehydes, sulfonyl. silicon moieties, halogens, sulfur containing moieties,
25 phosphorus containing moieties, and ettiylene glycols. . In tiie stiuctures depicted herein, R is

hydrogen when ttie position is unsubstituted. It should be noted that some positions may allow two
substitution groups, R and R', in which case ttie R and R* gnsups may be eittier ttie same or different

By -alkyt group" or grammatical equivalents herein is meant a straight or branched chain alkyI group,

3 0 vnth straight chain alkyI groups being preferred. If branched, it may be branched at one or more

positions, and unless specified, at any position. The alkyI group nnay range from about 1 to about 30
cartjon atoms (CI -C30), witti a prefenBd embodiment utilizing from about 1 to about 20 carbon atoms
(CI -C20), witfi about C1 ttirough about C12 to about C15 being preferred, and CI to C5 being
particulariy preferred, aRhough in some embodiments ttie alkyI group may be much larger. Also
3 5 included wittiln ttie definition of an alkyl group are cyclbalky I groups such as C5 and C6 rings, and
heterocyclfc rings witti nitrogen, oxygen, sulfur or phosphorus. AlkyI also includes heteroalkyi, witti
heteroatoms of sulfur, oxygen, nitiogen, and silicone being preferred. AlkyI includes substitiJted alkyl

wo 99/57317 PCT/US99/10104
groups. By -substituted alkyi group" herein is nneant an alkyi group further comprising one or more
substitution moieties *R*, as defined above.

By "amino groups* or grammatical equivalents herein is meant -NHj. -NHR and -NRj groups, with R
being as defined herein. .

By "nitro group° herein is meant an -NOj group. ■

By -suifur containing moieties" herein is meant compounds containing sulfur atoms, including but not
fimited to. thia-, thior and suHo- compounds, thiols {-SH and rSR). and sulfides (-RSR-). By
"phosphorus containing moieties" herein is meant compounds containing phosphorus, including, but
not Hmited to, phosphines and phosphates. By "silicon containing moieties" herein Is meant
compounds containing sHicoa

By "ether" herein is meant an -0-R group. Preferred ethers include alkoxy groups, with -CKCH^jjCHs
and -p-(CH2)<CH3 being preferred.

By "ester" herein is meant a -COOR group.

By "halogen" herein is meant bromine, todine. chtortne, or flubrine. Preferred substituted alkyls are
parfiaHy or fully halogenated alkyls such as CF3, etc.

By "aMehyde" herein is meant -RCHO groups.

By "alcohol" herein is meant -OH groups, and alkyi ateohob -ROK

By "amido" herein is meant -RCONH- or RCONR- grou(».

By "ethylene glycor or "(poWethylene glycol" herein is meant a -{O-CHj-CHj)^. group, although each
carbon atom of the ethylene group may also be singly or doubly substituted, i.e. -(0-CR,-CR,)„-. with
R as described above. Ethylene glycol derivatives with other heteroatoms in place of oxygen (i.e. -{N-
PM^i^- or -(S-CHfC^^-, or virith substitutton groups) are also preferred.

Preferred substHutton groups include, but are not limited to. methyl, ethyl, propyl, alkoxy groups such
a8-<>(CHa),CH, and -0KCHi)4CH, and ethylene glycol and derfvatlvM

wo 99/57317 PCTAJS99/10104

Preferred aromatic groups include, but are not limited to, phenyl, naphthyl, naphthalene, anthracene,
phenanthrbline, pyrole, pyridine, thiophene, porphyrins, and substituted derivatives of each of these,
iriduded fused ring derivatives.

In the conductive oligomers depicted herein, when g is 1, B-b is a bond linking two atoms or chemical
moieties. In a preferred embodiment B4) is a conjugated bond, containing overlapping or conjugated
n-orbitals.

Preferred B-D bonds are selected from acetylene (-C5C-. also called alkyne or ethyne), alkene (-
CH=CH-, also called ethylene), substituted alkene (•CR=CR-, -CH=CR- and -CR=CH-), amide (-NH-
CO- and -NR-CO- or -CO-NH- and -CO-NR-), azo (-N=N-). esters and thioesters (-C0-0-. -0-C0-, -
CS-O and -0-CS-) and other conjugated bonds such as {-CH=N-, -CRsN-. -N=CH- and -N=CR-), (-
i5iH=SiH-. ^iR=SiH-. -SiR=SiH-, and -SiR=SiR-). (-SiH=CH-. -SiR=CH-, -SiH=CR-. -SiR=CR-. -
CH=SiH-, -CR=SiH-, -CH=SiR-, and -CR=SiR-)^ Partfcularly preferred B-D bonds are acetylene,
alkene. amide, and substituted derivatives of these three, and azo. Especially preferred B-D bonds
are acetylene, alkene and amide. The oligomer components attached to double bonds may be In the
trans or cis conformation, or mixtures. Thus, either B or D may include cari)on, nitrogen or siHcon.
The substitutk>n groups are as defined as above for R.

When g=0 in the Structure 1 conductive oligomer, e is preferably 1 and the D moiety may be carbonyl
or a heteroatom moiety as defined above.

As above for the Y rings, within any single conductive oligomer, the B-D bonds (or D moieties, when
g=0) may be all the same, or at least one may be different For example, when m is zero, the terminal
B-D bond may be an amkie bond, and ttte rest of the B-D bonds may be acetylene bonds. Generally,
when amide bonds are present as few amide bonds as possible are preferable, but in some
enribodiments all the B-D bonds are amMe bonds. Thus, as outlined above for the Y rings, one type of
B-D bond may be present in the cohducGve oligomer virithin a monolayer as described below, and
another type above the monolayer level, for example to give greater flexibility for analyte - binding
l^and binding, when the capture binding l^and is attached via a conductive oligomer.

In the staictures depfeted herein, n is an integer from 1 to 50. although tonger oligomers may also be
used (see for example Schumm et al., Angew. Chem. Int Ed Engl 1994 33(1 3): 1360). Without
being bound by theory, it appears that for efficient association of binding ligands and targets, the
reactfon shoiiM occur at a distance from the surface. Thus, for exarnple, for nucleic add hybridization
of target nucleic ackis to capture probes on a surface, the hybridizatfon should occur at a distance
from the surface, t.e. the kinetics of hybridization increase as a function of the distance from the

W099/57317 PCT/US99/lbl04
surface, particulafly for long oligonucleotides of 200 to 300 basepairs. Accortlingly. when a nucleic
acid is attached via a conductive oligomer, as is more fully described below, the length of the
conductive oligomer is such that the closest nucleotide of the nucleic acid is positioned from about 6A
to about 100A (although distances of up to 500A may be used) from the electrode surface, with from
about 1 5A to about 60A being preferred and from about 25A to about 60A also being preferred.
Accordingly, n will depend on the size of the aromatic group, but generally will be from about 1 to
about 20. with from about 2 to about 15 being preferred and from about 3 to about 10 being especially
preferred.

In the structures depicted herein, m is either 0 or 1. That is, when m is 0. the cortducBve oligomer may
terminate in the B-D bond or D moiety, i.e. the D atom is attached to the capture binding ligand either
direcUy or via a linker. In some embodinrtents. for example when the conductive oligomer is attached
to a phosphate of the ribose-phosphate backbone of a nucleic add, there may be additional atoms,
such as a linker, attached between the conductive oligomer and the nucleic acid. Additionally, as
ouflined below, the D atom may be tiie nitrogen atom of the amino-modified ribose. Alternatively,
when m is 1. ttie conductive oligomer may terminate in Y. an aromatic group. i.e. the aromatic group is
attached to the capture binding ligand or linker.

As will be appreciated by those in the art. a large number of possible conductive oligomers may be
utilized. These include conductive oligomers falling witiiln the Structure 1 and Structure 8 formulas, as
well as other conductive oligomers, as are general^ known In the art, including for example,
compounds comprising fused aromatic rings or TeftorKBMIke oligomers, such as -{CF^-, -(CHFX,- and
-(CFR)„-. See for example, Schumm et al., Angew. Chen^ Ina Ed. Engl. 33:1361 (1994);6rTCShenny
et al.. Platinum Metals Rev. 40(1);26-35 (1996); Tour, Chem. Rev. 96:537-553 (1996); Hsung et al..
Organometallics 14:4808^815 (1995; and references cited tiierein. all of which are expressly
incorporated by reference.

Particularly preferred conductive oBgomers of this embodiment are depicted below:

Structure2

structure 2 Is Structure 1 when g is 1. Preferred embodiments of Structure 2 include: e is zero. Y is
pyrole or substituted pyrole; e is zero, Yisthiophene or substituted thiophene:
substituted furan; e is zero, Y is phenyl or substituted phenyl; e is zero. Y is pyridine or substituted
pyridine; e is 1, B-D Is acetylene and Y is phenyl 6r substituted phenyl (see Structure 4 below^. A
prefened embodiment of Sh^ture 2 is also when e is one, depicted as Structure 3 below:

WO 99/57317 PCT/US99/10104

SbvctureS

Preferred embodiments of Structure 3 are: Y is phenyl or substituted phenyl and B-D is azo; Y is
phenyl or substituted phenyl and B-D is acetylene; Y is phenyl or substituted phenyl and B-D is alkene;
Y Is pyridine or substituted pyridine and B-D is acetylene; Y is thiophene or substituted thiophene and
B-D is acetylene; Y is furan or substituted furan and B-D is acetylene; Y is thiophene or furan (or
substituted thiophene or furan) and B-D are alternating alkene and acetylene bonds.

Most of the structures depicted herein utilize a Structure 3 conductive oligomer. However, any
Structure 3 oligomers may be substituted with any of the other structures depicted herein, i.e.
Structure 1 or 8 oligomer, or other conducting oligomer, and the use of such Structure 3 depiction is
not meant to limit the scope of the invention.

Particularly preferred emtx>diments of Structure 3 include Structures 4, 5, 6 and 7, depicted below:

Structure 4

Particularly preferred embodiments of Structure 4 include: n is two, m is one, and R is hydrogen; n is
three, m is zero, and R is hydrogen; and the use of R groups to increase solubility.

Structure 5

When the B-D bontl is an amide bond, as in Structure 5, the conductive oligomers are pseudopeptkib
oiigdmers. Although the amide bond in Structure 5 is depicted with the carbonyl to the left, Le. -
CONH-, the reverse may also be used, i.e, -NHCO-. Partfcularly prefen-ed embodimerits of Structure
30 5 include: n is two. m is one, and R is hydrogen; n is three, m is zero, and R is hydR)gen (in this

embodiment, the tenninal nitrogen (the D atom) may be the nitrogen of the amino-nruxlified ribose);
and the use of R groups to increase solubilrty.

Structures

/ «

wo 99/57317 PCT/US99/10ld4

Preferred embodlments"Of Strocture 6 include the first n is tvlfo, sieoond n is one, m is zero, and all R
groups are hydrogen, or the use of R groups to increase solubility.

Structure?

PrefenBd embbdimfents of Structure 7 include: the first n is three, the second n is from 1-3. with m
being either 0 or 1 , and the use of R groups to increase solubility.

In a prefenred embodiment, the conductive oligomer has the structure depicted in Structure 8:

Structures

In this embodiment, C are cartwn atoms, n is an integer from 1 to 50, m is 0 or 1, J is a fieteroatom
selected from the group consisting of oxygen, nitrogen, silicon, phosphoois, sulfur, carbonyl or
sulfoxide, and G is a bond selected from alkane, alkene or acetylene, such that together with the two
carbon atoms the C-G-C group is an alkene (-CH=CH-), substihJted alkene (-CR=CR.) or mixtures
thereof (-CH=CR- or -CR=CH-), acetylene {-C5C-). or alkane (-CRj-CRj-, with R being either
hydrogen or a sutwtitutlon group as described herein). The G bond of each subunlt may be the same
or diflierent than the G bonds of other subunits; that fs, altemating oligomers of alkene and acetylene
bonds couW be usekf. etc. However, when G is an alkane bond, the number of alkane bonds in the
oligomer should be kept to a minimum, with about six or less sigma bonds per conducfive oligomer
being preferred. Alkene bonds are preferred, and are generally depkited herein, although alkane and

acetylene bonds may be substituted in any structure or en*odlment described herein as wll be
appreciated by those in the art

In some embodiments, for example when ETMs are not present, if m=0 then at least one of the G
bonds is not an alkane bond.

In a preferred embodiment, them of Structure 8 Is zero. Iii d partk:ulariy preferred embodiment, rhis
zero and G Is an alkene bond, as Is depicted in Slru(*jre 9:

Structures

wo 99/57317 PCT/US99/10104

The alkene oligomer of structure 9. and others depicted herein, are generally depicted in the prefeoed
trans configuration, although oligomers of cis or mixtures of trans and as may also be used. As

above, R groups may t)e added to alter the packing of the composifions on an electrode, the
hydrophilicity or hydrophobfcity of the oligomer, and the ffecibinty, i.e. the rotational, torsional or
longitudinal fliexibility of the oHgomer. n is as defined above.

In a preferred embodiment, R is hydrogen, although R may be also alkyi groups and polyethylene
glycols or derivatives.

In an alternative embodiment, the conductive oligomer may be a mixture of different types of
ofigomers. for example of structures 1 and 8. •

In addiSon. the terminus of at least some of the conductive oligomers in the monolayer are
electronfcally exposed. By "electronically exposed" herein is meant that upon the placement of an
ETM in ctose proximity to the temiinus. and after initiatnn with the appropriate signal, a signal
dependent on the presence of the ETM may be detected. The conductive oligomers may or may not
have terminal groups. Thus, in a prefierred embodiment, there is no addittonal terminal group, and the
conducthre oligonner temninates virith one of the groups depicted in Structures 1 to 9; for example, a B-
D bond such as an acetylene bond. Alternatively, in a preferred ernbodinrent, a terminal group is
added, sometimes depicted herein as "Q*. A terminal group may be used for severe reasons; for •
example, to contribute to the electronic availability of the conductive oligomer for detection of ETMs; or
to alter the surface of the SAM for other reasons, for example to prevent non-specific binding. For
example, there may be negatively charged groups on the terminus to form a negatively charged
surface such that when the target analyte is nucleic acid such as DMA or RNA, the nucleic acid is
repelled or prevented from lying down on the surface, to fadlitete hybridization. Prefen-ed tenninal
groups include -NHj, -OH. -COOH, and alkyI groups such as -CH„ and (poly)alkyloxides such as
(poly)ethylene glycol, with -OCHjCH^OH, -(OCH^CMPJ^H. -(OCHfiHfi)^. and ■{OCt^CHji»Jti
being preferred.

In one embodiment, it is possible to use mixtures of conductive oligomers vrtth different types of •
terminal groups. Thus, for example, some of the terminal groups may fadlitete detection, and some
may prevent non-specifk; binding.

It win be appreciated that the monolayer may comprise different conductive oligomer species, although
preferably the different species are chosen such that a reasonably uniform SAM can b^ fbrnied. Thus,
for exampte, when capture binding ligands are covalently attached to the electrode using conductive *
oligomers, it is possible to have one type of conductive oHgomer used to attach the captare binding

wo 99/57317 PCT/US99/10104

Mgand, and another type functioning to detect the ETM. Similarly, it niay be desirable to have mixtures
of different lengths of conductive oligomers In the monolayer, to help reduce non-specific signals.
Thus, for example, preferred embodiments utilize conductive oligomers that terminate below the
surface of the rest of the monolayer. I.e. below the insulator layer, if used, or below some fraction of
the other conductive oligomers. Similarly, the use of different conductive oligomers may be done to
facilitate monolayer fomiation, or to make monolayers with altered properties.

In a preferred embodiment, the monolayer may further comprise insulator moieties. By "Insulator"
herein Is meant a substantially nonconducting oligomer, preferably linear By "substantially
nonconducting" herein is meant that the insulator will not transfer electrons at 1 00 Hz. The rate of
electron transfer through the insulator is prefenrably slower than the rate through the cbnducfive
oligomers described herein.

In a preferred embodiment, the insulators have a conductivity, S, of about 10"^ Q'^cm'' or lower, with
less than about 1 0** n*^cm*V being prefen-ed. See generally Gardner et al., supra.

Generally, insulators are ali<yl or heteroalkyi oligomers or moieties with sigma bonds, although any
particular insulator molecule may contain aromatic groups or one or more conjugated bonds. By
"heteroalkyr herein Is meant an alkyi group that has at least one heteroatom. I.e. nitrogen, oxygen,
sulfur, phosphorus, silicon or boron included In the chain, Aftematively, the Insulator may be quite
similar to a conductive oligomer with the additton of one or more heteroatoms or bonds that serve to
inhibit or slow, preferably subsfantiaRy, electron transfer.

Suitable insulators are known in the art, and include, but are not limited to. -(CH2)„-, -(CRH)„., and -
(CR2)„-. ethylene glycol or derivatives using other heteroatoms in place of oxygen, i.e. nitrogen or
sulfur (sulfur derivatives are not prefen-ed wheri the electrode Is gold).

As for the conductive oligomers, the insulators may be substihited with R groups as defined herein to
alter the packing of the moieties or conductive oligomers on an electrode, the hydrophilicity or
hydrpphobfclty of the insulator, and the flexibility, i.e. the rotatfonal, torsional or tongitudinal flexibility of
the Insulator. For example, branched alkyI groups may be used. Similarly, the Insulators may contain
terminal groups, as outlined above, partfeularly to influence the surface of the monolayer.

The length ofthe species nrtaWngupthemonolayerwiDvary as needed. As outlined above, itappears
that binding is more efficient at a distance from the surface. The species to which capture binding
ligands are attached (as outlined below, these can be either Insulators or conductive ofigomers) may
be basically the same length as the monolayer fbnming species or tonger than them, resulting in the

wo 99/57317 PCTAJS99/10104

nucleic acids being more accessible to the solvent for hybridization. In some embodiments, the
conductive oligomers to virhich the capture binding ligands are attached may be shorter than the
monolayer.

5 As virill be appreciated by those in the art. the actual combinations and ratios of the different spedes
nraldng up the monolayer can vary widely. Generally, three component systems are preferred, with
the first species comprising a capture binding Irgand containing species (i.e. a capture probe, that can
be attached to the electrode via either an insulator or a conductive oligomer, as is more fully described,
below). The second species are the conductive oligomers, and the third species are insulators. In this

10 embodiment, the first species can comprise from about 90% to about 1%. with firom about 20% to
about 40% being prefen^ed. When the capture binding ligands are nucleic acids and the target is
nucleic add as well, from about 30% to about 40% is especially prefen^ for short oligonudeotide
targets and from about 10% to about 20% Is prefenred for longer targets. The second spedes can
comprise from about 1% to about 90%, with from about 20% to about 90% being preferred, and from

15 about 40% to about 60% being especially preferred. The third species can comprise from about 1% to
about 90%, with firom about 20% to about 40% being preferred, and firom about 15% to about 30%
being especially preferred. PrefiBrTed ratios of firstsecondrthird spedes are 2:2:1 for short targete,
1 :3: 1 for longer targets, with total thiol concentratfon In the 500 pM to 1 mM range, and 833 pM being
preferred.

In a preferred embodinnent two component systenr« are used, comprising the first and second
species. In this embodiment, the first species can comprise from about 90% to about 1%, with fi-om
about 1% to about 40% being prefenred. and from about 10% to about 40% being espedally preferred.
The second spedes can comprise from about 1 % to about 90%, with from about 1 0% to about 60%

2 5 being prefenred, and from about 20% to about 40% being especially prefenBd.

The covalent attachrhent of the conductive oligomers and insulators may be accorhpBshed In a variety
of ways, depending on the electrode and the compositton of the Insulators and conductive oligomers
used. In a prefen^ embodiment the attachment linkers with covalenOy attached capture binding

3 0 . ligands as depicted herein are covalently attached to an electrode. Thus, one end or terminus of the

attachment linker is attached to the capture binding ligand, and the other is attached to an electrode.
In some embodiments it may be desirable to have the attachment linker attached at a position ottier
than a terminus, or even to have a branched attachment linker that is attached to an electrode at one
terminus and to two or more capture binding ligands at other temiini, although this is not preferred.
3 5 Slmllarty, the attachment linker may be attached at two sites to the electrode, as is generally depicted
In Structures 11-13. Generally, some type of Bnker is used, as depicted below as "A" in Structure 10,
where "X' is ttie conductive oligomer, "r is an insulator and ttie hatched surface is the electrode:

wo 99/57317

PCT/US99/10104

Sbucture 10

In this embodiment. A is a linker or atom. The choice of "A" will depend in part on the characteristics
of the electrode. Thus, for example, A may be a sulfur moiety when a gold electrode is used.
Alternatively, when metal oxide electrodes are used. A may be a silicon (silane) moiety attached to the
oxygen of the oxide (see for example Chenetal, Langmuir 10:3332-3337 (1994); Lenhard et al., J.
Electroanal. Chem. 78:195-201 (1977), both of which are expressly incorporated by reference). When
carbon based electrodes are used. A n^y be an amino moiety (preferably a primary amine; see for
example Deinhammer et al., Langmuir 10:1306-1313 (1994)). Thus, preferred A moieties include, but
are not limited to, silane moieties, sulfur moieties (including alkyi sulfur moieties), and amino moieties.
In a prefen-ed embodiment, epoxide ^pe nnkages with redox polymers such as are known in the art
are not used.

Although depicted herein as a single moiety, the insulators and conductive oligomers may be attached
to the electrode with more than one "A" moiety; the "A* moieties may be the same or different. Thus,
for sample, when the electrode is a gold electrode, and "A" is a sulfur atom or moiety, multiple sulfur
atoms may be used to attach the conductive oligomer to the electrode, such as is generally depicted
bekw in Structures 11. 12 and 13. As will be appreciated by those in the art, other such structures
can be made. In Structures 1 1, 12 and 13, the A molely Is just a sulfur atom, but substituted sulfur
moieties may also be used.

Structure 11

wo 99/57317

PCT/US99/10104

Structure 13

It should also be noted that similar to Structure 13, it may be possible to have a a conductive oligomer
tenninating in a single carbon atom with three sulfur moities attached to the electrode. Additionally,
although not always depicted herein, the conductive oligomers and Insulators may also comprise a "Q'
terminal group.

In a preferred embodiment, the electrode is a gold electrode, and attachment is via a sulfur linkage as
is well known In the art. i.e. the A moiety is a sulfur atom or moiety. Although the exact characteristics
of the gold-sulfur attachment are not known, this linkage is considered covalent for the purposes of
this Invention. A representative structure is depicted in Structure 14. using the Structure 3 conductive
oligomer, although as for all the structures depicted herein, any of the conductive oligomers, or
combinatfons of conductive oligomers, may be used. Similarly, any of the conducBve oligomers or
insulators may also comprise temninal groups as described herein. Structure 14 depicts the "A" linker
as comprising just a sulfur atom, although additional atoms may be present (i.e. linkers from the sulfur
to the conductive oligomer or substitutton groups).

Structure 14

/
/

5 -Ay 8 d-V^y)—

In a preferred embodiment, the electrode Is a cartwn electrode, i.e. a glassy cariWn electrode, and
attachment is via a nitrogen of an amine group. A representative structure is depicted in Sfructure ^5.
Again, additional atonris nriay be present i.e. Z type Rnkers and/or terminal gw

Structure 15

wo 99/57317

PCT/US99/1Q104

Structure-16

.... f^— 'li^^ir

In Structure 16, the oxygen atom Is from the oxide of the metal oxide electrode. The Si atom may also
contain other atoms, i.e. be a silicon moiety containing substitution groups.

In a preferred embodiment, the electrode comprising the nrwnolayer including conductive oligomers
fiirther comprises a capture Wnding ligand. By 'capture binding ligand* or "capture landing species" or
'capture probe' herein is meant a confound that is used to probe for the presence of the target
analyte. that will bind to the target analyte. Generally, the capture binding Hgand aflows the attachment
of a target analyteto the electrode, for the purposes of detection. As is more fully outlined below,
attachment of the target analyte to the capture probe may be direct (l.e. the target analyte binds to the
capture binding ligand) or indirect (one or more capture extender Irgands are used). By 'covalentiy
attached" herein is meant that two moieties are attached by at least one bond, including $igma bonds,
pi t)onds and coordination bonds.

In a preferred ennbodiment, the binding is specific, and the binding ligand is fart of a binding pair. By
"specifically bhd" herein is meant that the ngand biiids the analyte. with specificity sufficient to
differentiate between the analyte and other components or contaminants of the test sampl& However,
as wfll be appreciated by those in the art, it will be possible to detect arialytes using binding which Is
not highly specific; for example, the systems may use different tending ligahds. for exampte an array of
different l^ands, and detection of any particular analyte is via its "signature" of binding to a panel of
binding ligands, similar to the manner In which "etectronic noses' work. This finds particular utfflty In
the detection of chemical analytes. The binding should be sufficient to remain bound under the
conditions of ttie assay, including vrash steps to remove non-specific binding. In some embodlmerits,
for example in the detection of certain bioniolecules, the binding constente of the analyte to the
binding ligand will be at least about 104-106 M-1, with at least about 105 to 109 M-1 being preferred
and at least about 107 -109 M-i being particularly preferred.

As vwTI be appreciated by those in the ari the cbmpbsHlbn of the binding ligand will depend on the
composition of flie target analyte. Binding IJgands to a wWe variety of analytes are known or can be
readiV found using known techniques. For example, vyhen the analyte Is a singte-stranded nudeic
add, the binding Hgand may be a comptementeiy nucteic add. SImHarly, the analyte may be a nuctek:
add binding protein and the capture binding rigand is either single-stranded or doubfe stranded nudeic

wo 99/57317 PCT/US99/10ia4
add; allematively, the btndtng Itgand may be a nucleic acid-binding protein when the analyte is a
single or double-stranded nucteb acid. When the analyte is a protein, the binding ligands include
proteins or small molecules. Preferred binding l^and proteins include peptides. For example, when
the analyte is an enzyme, suitable binding ligands include substrates and inhibitors. As wiM be
appreciated by those in the art, any two molecules that will associate may be used, either as an
analyte or as the binding ligand. Suitable analyte/binding ligand pairs include, but are not limited to,
antibodies/antigens, receptors/ligands, proteins/nucleic acid, enzymes/substrates and/or inhibitors,
carbohydrates (including glycoproteins and glycolipids)/lectins, proteins/proteins, proteins/small
molecules; and carbohydrates and their binding partners are also suitable analyte-binding ligand pairs.
These may be wild-type or derivative sequences. In a preferred embodiment, the binding ligands are
portions (particularly the extracellular portions) of cell surface receptors that are known to multimerize,
such as the growth hormone receptor, glucose transporters (particularly GLUT 4 receptor), transfem'n
receptor, epidennal growth factor receptor, low density lipoprotein receptor, h^h density lipoprotein
receptor, epidenmal growth factor receptor, leptin receptor. Interfeukin receptors including IL-1. IL-2,
IL-3. IL^, IL-5. IL^, IL-7. IL-8. IL-9. IL-II. 11-12. IL-13. IH5, and IL-17 receptors, human growth
hormone receptor. VEGF receptor, PDGF receptor, EPO receptor. TPO receptor, ciliary neurotrophic
factor receptor, prolactin receptor, and.T-cell receptors.

The method of attachment of the capture binding ligand to the attachment linker will generally be done
as is known in the art and will depend on the composition of the attachment linker and the capture
binding ligand. In general, the capture binding ligands are attached to the attachment linker through
the use of functional groups on each that can then be used for attachment Preferred functional
groups for attachment are amino groups, carboxy groups, oxo groups and thiol groups. These
functional groups can then be attached, either directly or through the use of a linker, sometimes
depicted herein as 'Z*. Linkers are known in the art; for example, homoK)r hetero-bifunctional linkers
as are well known (see 1994 Pierce Chemfcal Company catatog, technical secHon on cross-linkers,
pages 155-200, incorporated herein by reference). Preferred Z linkers Include, but are not limited to.
alkyi groups (including substituted alky! groups and alkyi groups containing heteroatom moieties), with
short alkyi groups, esters, amWe. amine, epoxy groups and ethylene glycol and derivatives being
preferred. Z may also be a sulfone.group, fonming suifonamkle.

In this way, capture binding ligands comprising proteins, lectins, nucleic acids, small organfc
molecules, carbohydrates, etc. can be added.

In a preferred embodiment the capture binding Hgand is attached directly to the electrode as outlined
herein, for exampte via an attachment linker. Altematively, the capture binding Bgand may utilize a
capture extender component such as depicted In Figure 2C. in this embodiment the capture binding

wo 99/57317 PCTAJS99/I0104
ligand comprises a first portion that will bind the target analyts and a second portion that can be used
for attachment to the surfece. Figure 2C depicts the use of a nudeic add component for binding to the
surface, although this can be other binding partners as well.

A prefenBd embodiment utilizes proteinaceous capture binding ligands. As Is Itnown In the art, any ,
number of techniques may be used to attach a proteinaceous capture binding llgand. "Protein* in this
context includes proteins, polypeptides and peptides. A wide variety of techniques are known to add
moieties to proteins. One prefened method is outlined in U.S. Patent No. 5,620,850, hereby
Incorporated by reference In its entirety. The attachment of proteins to electrodes is known; see also
Heller, Acc. Chem. Res. i23:128 (1990), and related worie

A prefened embodiment utilizes nucleic iacids as the capture blndfrig llgand. for example for when the
target analyte is a nudete add or a nucleic add binding protem. or when the nucleic add serves as an
aptamer for binding a protein; see U.S. Patents 5,270,163. 5,475.096, 5.567.588. 5.595,877.
5.637,459, 5,683,867.5,705,337. and related patents, hereby incorporated bf reference. In this
embodiment, the nucleic add capture binding ligand is covalently attached to the electrode, via an
"attachment Rnlter", that can be either a conductive oligomer or via an Insulator. Thus, one end of the
attachment linl^er is attached to a nudeic acid, and the ottier end (although as will be appreciated by
those In the art. it need not be ttie exad temiinus for either) is attached to the electrode. Thus, any of
structures 1-1 6 rhay further comprise a nudeic add effectively as a tennlnal group. Thus, the present
Invention provides compositions comprising binding ligands covalently attached to electrodes as is
generally depicted below In Structure 17 fora nucleic add:

Structure '17

-Ft «XwO F, nucMesdd

In Stmcture 17, the hatched merits on the left represent an electrode. X Is a conductive ollgorher arid I
Is an insulator as defined herein. F, is a linkage that altows the covatent attachment of the electrode
and the conductive oi^mer or insulator, including bonds, atoms or linkers such as is described
herein, fbr example as'A" defined betow. Fits a linkage that atows the covatent attachment of the
conductive oligomer or insulator to Ihe binding llgand. a nudeic add in Stmcture 17. and may be a
bond, an atom or a Hnkage as Is hereh described. F, may be part of the condudive oT^omer. part of
the insulator, part of the binding ligand, or exogeneous to both, for exampte. as defined herebi for T.

wo 99/57317 PCTAJS99/10104

fn general, the methods, synthetic schemes and compositions useful for the attachment of capture
binding ligands, particularly nucleic adds, are outlined in WO98/20162, PCT US98/12430, PCT
US98/12082; PCT US99/01705 and PCX US99/01703. alt of which are expressly incorporated herein
by reference in their entirety.

In a preferred embodiment, the capture binding ligand is covalently attached to the electrode via a
conductive oligomer. The covalent attachment of the binding ligand and the conductive ol'^bmer may
. be accomplished in several ways, as will be appredated by those in the art

10 In a prefen^ed embodiment, the capture binding ligand Is a nucleic acid, and the attachment Is via
attachment to the base of the nucleoside, via attachment to the backbone of the nucleic acid (either
the ribose. the phosphate, or to an analogous group of a nucleic acid analojg backbone), or via a
transition metal ligand, as described below. The techniques outlined below are generally described for
naturally occuring nucleic acids, although as will be appreciated by those in the art. similar techniques

15 ipay be used with nudeic add analogs.

In a prefenred embodiment, the conductive oligomer is attached to the base of a nucleoside of the
nuclefc ackJ. This may be done in several ways, depending on the oligomer, as Is described below. In
one embodiment, the oligomer is attached to a temiinal nucleoside, i;e. either the 3* or 5' nudeoside of
20 the nudeic acid. Alternatively, the conductive oligomer is attached to an internal nucleoside.

The point of attachment to the base will vary with the base. Generally, attachment at any position is
possible. In some embodiments, for example when the probe containing the ETMs may be used for
hybridization, it is preferred to attach at positions not involved in hydrogen bonding to the
2 5 . complementary base. Thus, for example, generally attachment is to the 5 or 6 position of pyrimidlnes
such as uridine, qrtosine and thymine. For purines such as adenine and guanine, the linkage is
preferably via the 8 position. Attachment to non-standard bases is preferably done at the comparable
posittons.

.30 In one embodiment, the attachment is direct; that Is. there are no intervening atoms between the
conductive oligomer and the base. In this embodiment, for example, conductive oligomers with
terminal acetylene bonds are attached directly to the base. Structure 1 8 is an example of this linkage,
using a Structure 3 con(Juctive oligomer and uridine as the base, although other bases and conductive
oligomers can be used as will be appredated by those in the art

WO 99/57317 PCT/US99/10104

Structure 18

It should be noted that the pentose structures depicted herein may have hydrogen, hydroxy.
1 0 phosphates or other groups such as amino groups attached. In addition, the pentose and nucleoside
structures depicted herein are depicted non-conventlonally. as mirror images of the nonnal rendering.
In addition, the pentose and nucleoside structures may also contain additional groups, such as
protecting groups, at any posftlon. for example as needed during synthesis.

15 In addition, the base may contain additional modifications as needed. Le! the carbonyl or amine groups
may be altered or protected.

In an alternative embodiment, the attachment is any number of different Z linkens. including amide and
amine linkages, as is generally depfcted in Structure 19 using uridine as ttie base and a Structure 3
20 oligomer

Structure 19:

In this embodiment. Z is a finker. Preferably, Z is a short linlcer of about 1 to about 10 atoms, with from
1 to 5 atoms being preferred, that may or may not contain a!l<ene. allcynyl, amine, amide, azo. imine,
etc., bonds. Unters are kiftown in the art; for example, homo^r hetercKbiftihctiorial linkers as are well
known (see 1994 Pierce Chemfcal Company catatog, technfeal section on cross-nnkers. pages
155-200, incorporated herein by reference). Preferred Z linkers include, Inrt are hot Bmited to, alkyi
groups (including substituted aikyi groups and all^l groups containing hetieroiatom moieties), with short
alkyI groups, esters, amide, amntie, epoxy groups and ethylene glycol and derivatives being preferred,
with propyl, acetylene, and Cj alkene being especially preferred. Z may also be a sulfbne group,
foiming sulfonanrdde linkages as discussed bekyw.

wo 99/57317 PCTAJS99/l6l04

In a preferred embodiment, the attachment of the nudeic acid and the conductive oligomer is done via
attachment to the backbone of the nudeic acid. This may be done in a number of ways, including
attachment to a ribose of the ribose-phosphate backbone, or to the phosphate of the backbone, or
other groups of analogous backbones.

As a preliminary matter, it shouW be understood that the site of attachment in this embodiment may be
to a 3* or 5* temiinal nucleotide, or to an internal nudeotkJe, as is nrore fully described bekw.

In a preferred embodiment, the conductive oligomer is attached to the ribose of the ribose-phosphate
backbone. This may be done in several ways. As Is known in the art, nucleosides that are modified at
either the Z or 3* position of the ribose with amino groups, sulfur groups, silicone groups, phosphorus
groups, or oxo groups can be tmde (Imazawa et al., J. Org. Chem., 44:2039 (1979); Hobbs et al.. J.
Org. Chem. 42(4):7i4 (1977); Verheyden et al.. J. On-g. Chem. 36(2):250 (1971); McGee et al., J.
Org. Chem. 61:781-785 (1996); Mikhailopulo et al.. Liebigs. Ann. Chem. 513-519 (1993); McGee et al..
Nucleosides & Nudeotides 14(6):1329 (1995). all of which are incorporated by reference): These
nnodified nucleosides are then used to add the conductive oligomers.

A preferred embodiment utilizes amino-niodifjed nucleosides. These amino-nrKxlifled riboses can then
be used to form either amide or amine linkages to the conductive oligomers. In a preferred
embodiment, the amino group Is attached directly to the ribose. although as will be appreciated by
those in the art short linkers such as those described herein for "Z" may be present betweeri the
amino group.and the ribose.

In a preferred embodiment, an amide linkage is used for attachment to the ribose. Preferably, if the
conductive oligomer of Stmctures 1-3 is used, m Is zero and thus the conductive oligomer terminates
In ttie amide bond. In this embodiment, the nitrogen of the amino group of the a^mino-rnodified ribose
Is the "D" atom of the conductive oligomer. Thus, a preferred attachnient of this emlk^^
depfcted in Structure 20 (using the Structure 3 conductive oligomer):

Structure 20 .

As wlB be appreciated by those in the art. Structure 20 has the terminal bond fixed as an amide bond.

In a preferred embodiment a heteroalbm Rnloge is used, i.e. oxo. amine, sulfur, etc. A preferred
embodiment ufiHzes an amine linkage. Again, as outDned above for the amide linkage! for amine

W099/57317 PCT/US99/10104
linkages, the nitrogen of theaminoHnodified ribose may be the tr atom of the conductive oHgomer
when the Structure 3 conductive oligomer is used.. Thus, for example. Structures 21 and 22 depict
nudebsides writh the Structures 3 and 9 conductive oligomers, respectively, using the nitoogen as the
heteroatom, athough other heteroatoms can be used:

Structure 21

lnStaicture21. preferably both m and tare not zero. A preferred 2 here Is a methylene group,
other aliphatic alkyi linkers. One. two or three carbons in this position are particularly useful for
synthetic reasons.

Structure 22

In Structure 22. Z is a? defined above. Suitable nnkers include methylene and ethylene

In an alternative embodiment, the qonductive oligomer is covaiently attached to the nucleic acid via the
phosphate of the ribosei)hosphatB backbone {or anatog) of a nucleic ackJ. In this embodiment, the
attachment is direct, utilizes a linker or via an amide bond. Stnidure 23 deptets a direct Hnkage. and
Structure 24 depicts linkage via an amide bond (both utilize the Structure 3 conductive oligomer
although Structure 8 conductive oligomers are also possible). Structures 23 and 24 depict the
conductive oligomer in the 3' position, although the 5' positron is also possible. Furthermore, both
Structures 23 and 24 depict naturally occuning phosphodiester bonds, although as those in the art will
appredate, non-standard analogs of phosphodiester bonds may also be used.

Structure23

In Structure 23. if the temiinal Y is present a.e. m=1). then preferably Z Is not present 0.e. t^O). If the
tenninal Y is not present, then Z.is preferably pr^ent

WO 99/57317 PCTAJS99/10104

Structure 24 depicts a preferred embodiment, wherein the tenminal B-D bond is an amide bond, the .
terminal Y is not present and Z is a linker, as defined herein.

Structure 24

B 0^ V— C M Z P

10 In a prefen-ed embodiment, the conductive oligomer is covalently attached to the nucleic acid via a

transition metal ligand. In this embodiment, the conductive oligomer is covalently attached to a ligand
which provides one or more of the coordination atoms for a transition metal. In one embodiment, the
ligand to which the conductive oligomer is attached also has the nucleic acid attached, as Is generally
depicted below in Structure 25. Altemativeiy, the conductive oligomer is attached to one ligand. and

15 the nucleic acid is attached to another ligand, as is generally depicted below in Structure 26. Thus, in
the presence of the transition metal, the conductive ol^onner is covalently attached to the nucleic acid.
Both of these structures depict Structure 3 conductive oligomers, although other oligomers may be
utilized. Structures 25 and 26 depict two representative structures for nucleic acids; as will be
appreciated by those in the art. if is possible to connect other types of capture binding ligands, for

2 0 example proteinaceous binding ligands, in a similar nnanner

Structure 25

Structure 26

In the structures depicted herein, M is a metal atom, with transition metals being preferred. Suitable
transition metals for use in the invention include, but are not limited to, cadmium (Cd). copper (Cu),
cobalt (Co), palladium (Pd), zinc (Zn). iron (Fe), mthenium (Ru). rhodium (Rh), osmium (Os), rhenium
(Re), platinium (R), scandium (Sc), titanium (Ti), Vanadium (V), chromium (Cr), rhanganese (Mn),
3 5 nickel (NO. Molybdenum (Mo), technetium (Tc). tungsten (W). and iridium (Ir). That Is, the first series
of transition metals, the platinum metals (Ru, Rh, Pd, Os. Ir and Pt), along with Fe, Re. W. Mo and Tc.
are preferred. Particularly preferred are ruthenium, rhenium, osmium, platinium, cobalt and iron.

wo 99/57317 PCT/US99/10104
L are the co^gands. that provfde the coordination atoms for the binding of the metai ion. As will be
appredated by those in the art. the number and nature of the co-ligands will depend on the
coordination number of the metal Ion. Mono-, dl- or polydentate co^igands may be used at any
position. Thus, for example, when the metal has a coordination number of six. the L from the tenninus
of the conductive oligomer, the L contributed from the nucl^ add. and r. add up to six. Thus, when
the metal has a coordination number of six. r may range from zero (when all coordination atoms are
provided by the other two figands) to four, when all the co-ligands are monodentate. "mus general^, r
wfll be from 0 to 8. depending on the coordination number of the metal ion and the choice of the other
ligands.

In one embodiment, the metal ion has a coordination number of six and both the iigand attached to the
conductive oT^omer and the Iigand attached to the nudeic acid are at least bidentate; that is. r is
preferably zero, one (l.e. the remaining co^igand is bidenlate) or two (two monodentate co-ligands are
used).

As will be appreciated in the art, the co^igands can be the same or different Suitable ligands M into
two categories: ligands whidi use nitrogen, oxygen; sulfur, carbon or phosphorus atoms (depending
on the metal ion) as the coordination atoms (generally referred to in the literature as sigma (a) donors)
and organomelalllc ligands sud, as metallocene ligands (generally referred to in the literature as pi (n)
donors, and depicted herein as U- Suitable nitrogen donating ligands are well Icnown in the art and
Indude. but are not limited to. NH^ NHR; NRR'; pyridine; pyrazirie; isonicotinamide; imidazole;
bipyrldin? and substituted derivatives of bipyrldlne; terpyridihe and substituted derivatives;
phenanthrolines. particularly 1.1(H>henanthroline (abbreviated phen) and substituted derivatives of
phenanthrolines sudi as 4.7^lmethylphenanthronne and djpyridop.2-a:2'.3'<Jphenaziiie (abbreviated
dppz); dipyridophenazine; 1.4.5.8.9.12-hexaazatrlphenytene (abbreviated hat); 9.10-
phenanthrenequinone diimine (abbreviated phi); 1.4.5.8^etiaazaphenanthrBne (abbreviated tap); .
1.4.8.11.tetra-azacydotetradecane(abbrBviatedcyclam),EDTA.EGTAandlsocyanlde. Subset^
derivatives, induding fused derivatives, may also be used. In some embodiments, porphyrins and
substituted derivatives of the porphyrin family may be used. See for example. Comprehensive
CoordinatlonChemlstry. Ed. Wilkinson et al.. Pergammon Press, 1987. Chapters 13.2 (pp73.98) 21 1
(pp. 813^8) and 21.3 (pp915^7). all of whid, are hereby expressly incorporated by referenca

Suitable Sigma donating Bgands using carbon, oxygen, sulfur and phosphorus are known in the art

For exampte. suitable Sigma carbon donors are found In Cotton and Wlkenson. Advam^
Chemistry, 5th Edition. JohnVWIey&Spns. 1988. hereby Incorpor^ for
example. Similarty, sulteble oxygen ligands Indude crown ethers, water and others known in the art
Phosphines and substituted phosphines are also suiteble; see page 38 of Cotton arid WBkenson

wo 99/57317

PCT/US99/10ia4

The oxygen, suffur, phosphorus and nitrogen-donating ligands are attached in such a manner as to
allow the heteroatonr^s to serve as coordination atoms.

In a prefened embodiment, organorrietalltc iigands are used. In addition to purely organic compounds
5 for use as redox moieties, and various transition metal coordination complexes with 5-bonded ovgantc
ligand with donor atoms as heterocyclic or exocycGc sut>stituents. there is available a wide variety of
transition metal organometallic compounds with n-bonded organic iigands (see Advanced Inorganic
Chemistry, 5th Ed., Cotton & Wilkinson, John Wiley & Sons. 1988, chapter 26; Organometailics, A
Concise Introduction, Elschenbroich et al., 2nd Ed.. 1992, VCH; and Comprehensive Organometallic

10 Chemistry II, A Review of the Literature 1982-1994. Abel etaL Ed., Vol. 7. chapters 7, 8. 10 & 11.

Pergamon Press, hereby expressly incorporated by reference). Such organometallic Iigands include
cyclic aromatic compounds such as the cyclopentadienide ion (CsHjC-l)] and various ring substituted
and ring fused derivatives, such as the indenylide (-1) ion. that yield a class of bis(cyclopentadieyl)
metalcompounds. (i.e. the metallocenes); see for example Robins etal., J. Am. Chem. Soc.

15 104:1882-1893 (1982); and Gassnranetal., J. Am. Chem. Soc. 108:4228-4229(1986).

incorporated by reference. Of these, fen^cene I(C5H5)2FeJ and its derivatives are prototypical
examples which have been used in a wide variety of chemical (Connelly et aL. Chem. Rev. 96:877-
910 (1996). incorporated by reference) and eleclrochemicai (Geiger et a!., Advances in Organorhetallic
Chemistry 23:1-93; and Geiger et al.. Advances in Organometallic Chemistry 24:87, incorporated by

2 0 reference) electron transfer or "redox" reactions. Metallocene derivatives of a variety of the first.

second and third row transition metals are potential candidates as redox moieties that are covalently
attached to. either the ribose ring or the nucleoside base of nucleic acid. Other potentially suitable
organometallic Iigands include cyclic arenes such as benzene, to yield bis(arene)metal compounds
and their ring substituted and ring fiised derivatives, of which bis(benzene)chromium is a prototypical

25 example. Other acyclic n-bonded Iigands such as the allyl(-l) ion, or butadiene yield potentially
suitable oiiganometallic compounds, and all such Iigands. In conjuction with other n-bonded and 5-
bonded Iigands constitute the geheral class of organometallic compounds in which there Is a metal to
caritxm bond. Electrochemical studies of various dimers and oligomers of such compounds with
bridging organic Iigands, and additional non-bridging Iigands, as well as with and without metaknetal

30 bonds are potential candidate redox nrK>ie6es in nucleic acid anaVs^^

When one or more of the co-ligands is an organometallic ligand, the ligand is generally attached via
one of the carbon atoms of the organometalfic ligand. although attachment may be via other atoms fbr
heterocyclic Iigands. Prefenred organometallic Iigands include metallocene Figands, including
35 substituted derivatiyes and the metalloceneophanes (see page 1 1 74 of Cotton and Wilkenson. supra):
For example, derivatives of metallocene Iigands such as methylcyclopentadienyl, with multiple methyl
groups being preferred, such as pentamethylcyctopentadienyl. can be used to Increase the stability of

W099/57317 PCT/yS99/10104

the metaBocene. m a preferred embodnnent, only one of the Mk) metaliocene Hgands of a metallocene
arederivatized.

As described herein, any combination of ligands may be used. Preferred combinations include: a) all
ligands are nitrogen donating ligands; b) all ligands are organometalHc Hgands; and c) the ligand at the
terminus of the conductive oligomer is a metallocene ligand and the ligand provided by the nucleic acid
is a nitrogen donating ligand. with the other ligands. if needed, are either nitrogen donating ligands or
metallocene ligands, or a mixture. These combinations are depicted in representative structures using
the conductive oligomer of Structure 3 are depicted in Structures 27 (using phenanthroline and amino
as representative ligands). 28 (using ferrocene as the metal-ligand combination) and 29 (using
cydopentadienyl and amnio as representative ligands).

Structure 27

Structure 28

Structure 29

.O
bas

In a preferred embodiment the ligands used in the invention showi^ altered fluoroscent properties
depending on the redpx slate of the chelated metal ion. As described below, this thus serves as an
additional mode of detection of eteclron transfer between Mie ETM and the elec^

In a preferred embodiment, as is described mors fiiUy below; the Kgand atfeched to the nucleic acid is
anamlnogroupattachedlothe2'orypo8ltlonofariboseoftheribo8ei)ho8phateb^ This -
ligand may contain a multipHcity of amino groups so as to form a poiydentate ligand which binds the
metal ion. Other preferred ligands include cyclopentadfene and phenanthroline.

W099/573fl7

PCTAJS99/10ia4

The use of metal ions to connect the binding ligands such as nudeic acids can serve as an internal
control or calibratloh of the system, to evaluate the number of available binding ligands on the surface.
However, as will be appreciated by those in the art, if metal ions are used to connect the bindirig
ligands such as nucleic acids to the conductive oligomers, it is generally desirable to have this metal
ion complex have a different redox potential than that of the ETMs used in the rest of the system, as
described below. This is generally true so as to be able to distinguish the presence of the capture
probe from the presence of the target analyte. This may be useful for identification, calibration and/or
quantification. Thus, the amount of capture probe on an electrode may be compared to the amount of
target analyte to quantify the amount of target sequence in a sample. This is quite significant to serve
as an internal control of the sensor or system. This allows a measurement either prior to the addition
of target or after, on the saOM molecules that win be used for detection, rather than rely on a similar
but different control system. Thus, the actual molecules that will be used for the detection can be
quantified prior to any experiment This is a significant advantage over prior methods.

In a preferred embodiment, the capture binding ligands are covalently attached to the electrode via an
insulator. The attachment of a variety of binding ligands such as proteins and nucleic adds to
insulators such as alkyi groups is well known, and can be done to the nucleic add bases or the
backbone, including the ribose or phosphate for backbones containing these moieties, or to alternate
backbones for nucleic acid analogs, or to the side chains or backbone of the amino acids.

In a preferred emt)odinient there may be one or more different capture binding ligand species
(sometimes referred to herein as "anchor ligands", "anchor probes" or "capture probes" with the
phrase "probe" generally refening to nucleic acid spedes) on the surface, as is generally depteted in
the Figures. In some embodiments, there may be one ^pe of capture binding ligand, or one type of
capture binding ligand extender, as is more fully described betow. Alternatively, differisnt capture
binding ligands. or one capture bincJing ligand with a.multipHctly of different capture extender binding
ligands can be used. Similarty, when nudefc add systems are used, ft may be desirable to use
auxiliary capture probes that comprise relatively short probe sequences, that can be used to ""tack
down" components of the system, for example the recruitment linkers, to increase the concentration of
ETMs at the surface.

Thus the present invention provides electrodes comprising monolayers comprising conductive
oHgorners and capture binding r^ands, useful in target analyte detection s

In a preferred embodiment, the compositions furttier comprise a solution binding ligand. Solution
binding ligands are similar to capture binding ligands, in that Oiey bind to target analytes. The solution

wo 99/57317 PCT/US99/10ia4
binding ligand may be the same or different from the capture binding Bgand. Generally, the soluBon
binding ligands are not diiedly attached to the surface, although as depicted In F«ure 5A th^ may be.
The solution binding ligand either directly comprises a recruitment linker that comprises at least one
ETM. or the recruitment linker is part of a label probe that vwll Wnd to the solutio

Thus, "recmitment linkers" or 'signal carriers" with covalently attached ETMs are provided. The terms
"electron donor moiety", "electron acceptor moiety", and "ETMs" (ETMs) or grammatical equivalents
herein refers to molecules capable of electron transfer under certain conditions. It is to be understood
that electron donor and acceptor capabilities are relative; that is. a molecule which can lose an
electron under certain expernnental conditions will be able to accept an electron under different
©cperimental conditions. It is to be understood that the number of possible electron donor moieties
and electron acceptor moieties Is very large; and that one skilled In the art of etecbon tra^
compounds will be able to utilize a number of compounds in the present inventfon. Preferred ETMs
include, but are not limited to. transition metal complexes, organic ETMs. and electrodes.

In a prefened embodiment, the ETMs are transition metal complexes. Transition metals are those
whose atoms have a partial or complete d shell of electrons. Suitable transition metals for use in the
invention are listed above.

The transitton metals are cdmplexed with a variety of ligands. L, defined above, to form suitable
transitton metal complies, as Is well known in the art

In additkm to transition metal complexes, other organb electron donors and acceptors rhay be
covalently attached to the nucleic acM for use in the ihventiori. These organic rnolecufes include, but
are not limited to. riboflavin, xanthene dyes, azine dyes, acridlne orange. /V,/\r-dimethyj.2.7-
diazapyrenium dichloride (DAP^*), methylvlotogen, ethidium bromide, quinones such as N.N*-
dimethylanthra{2.1.9-d6«,5.10-d'eir)diisoquinoline dichtoride (ADjiQ*'); porphyrins (lmesb-letr^kls(N-
methyl-x-pyridinium)porphyrin tetrachtoridej. variamine blue B hydrochloride. Bindschedlei's green;
2.6-dichk)rolndophenol, 2.6KJibromophenolindophenol: Brilliant crest blue (3-amino-9Kiimettiyl-amirK).
10^nethylphenoxyazine chloride), methylene blue; Nile blue A (aminoaphthodiethylaminophenoxazlne
sulfate). lndigo^.5'.7,7'4etrasullbnlc add. indigo-5.5'.7-trisulfonte acid; phenosafranine. indig6-5-
nfKWJOsulfonfc acid; safranlne T; bis(dimethylglyoximato)^rDn(ll) chtoride; induline scariet. neutral red,
anthracene, coronene, pyrene. d^henylanthracene. rubrene, binaphthyl. DPA, phenolhlazene.
fiuoranthene. phenanthrerie. chrysene. 1.8KliphenyH.3.5.7-octatetracene, naphthalene,
acenaphthalene. perylene, TMPD and anatogs and subsitituted derivathres of these compounds.

wo 99/57317 PCTAJS99/10104
In one embbdimjsnt the electron donors and acceptors are redox proteins as are Icnown in the art
However, redox proteins in niany embodinrtents are not preferred.

The choice of the spedfic ETMs will be influenced by the type of electron transfer detection used, as is
generally outlined below. Preferred ETMs are metallocenes, with ferrocene being particularly
preferred.

In a prefen-ed embodiment a plurality of ETMs are used. As is shown in the examples, the use of
multiple ETMs provides signal amplification and thus allows more sensitive detection limits.
Accordingly, pluralities of ETMs are prefeaed, with at least about 2 ETMs per recruitment linker being
preferred, and at least about 10 being particularly prefen^d. and at least about 20 to 50 being
especially prefen-ed. In some instances, very large numbers of ETMs (100 to 1000) can be used.

As will be appreciated by those In the art the portion of the label probe (or target in some
embodiments) that comprises the ETMs (termed herein a 'recruitment linker* or "signal camer") can
be nucleic add, or it can be a rion-nuclefc add linker that links the solution binding ligand to the ETMs.
Thiis, as will be appreciated by those in the art. there are a variety of configurations that can be used.
In a prefenred embodiment the recniitment linker is nudefc add (including analogs), and attachment of
the ETMs can be via (1) a base; (2) the backbone, including the ribose, the phosphate, or comparable
structures in nucleic acid analogs; (3) nudeoside replacement described below, or (4) metallocene
polymers, as described below. In a prefen-ed embodiment the recruitment linker is non-nudeic ackl,
and can be either a metallocene polymer or an alkyl-type polymer (induding heteroalkyi, as is more
fully diescribed below) containing ETM substitution groups. These options are generally depicted in
Figure 44.

In a preferred embodiment the recruitment linker is a nudeic add, and comprises oovalentty attached
ETMs. The ETMs may be attached to nucleoskJes within the nucleic add in a variety of positions.
Preftenred embodiments indude, but are not limited to, (1) attachment to the base of the nudeosWe, (2)
attachment of the ETM as a base replacement (3) attachment to the backbone of the nudeic add,
induding either to a ribose of ttie riboseiDhosphate backbone or to a phosphate moiety, or to
analogous structures in nudeic add anatogs, and (4) attachment via metaflocene polymers, with ttie
latter being preferred.

In addition, as is described below, when ttie recruitment linker is nucleic add, it may be desirable to
use secondary label probes, that have a first portion tt>at will hybridize to a portion of ttie primary label
probes and a isecond portion comprising a recruitment linker as is defined herein. This is generally

wo 99/57317 PCTAJS99/10104
deplct«l In Figure 39Q and 39R; this is similar to the use of an amplifier probe, except that both the
primary and the secondary label probes comprise ETMs.

In a preferred embodiment, the ETM Is attached to the base of a nucleoside as is generally outlined
above for attachment of the conductive oligomer. Attachment can be to an internal nucleoside ora
terminal nucleoside.

The covalent attachment to the base will depend in part on the ETM chosen, but in general is similar to
the attachment of conductive oligomers to bases, as outlined above. Attachment may generally be
done to any position of the base. In a preferred embodiment, the ETM is a transition metai complex,
and thus attachment of a suitable metal ligand to the base leads to the covalent attachment of ttie
ETM. Alternatively, similar types of linkages may be used for the attachment of organic ETMs. as will
be appreciated by ttiose in the art

15 In one embodiment, the C4 attached amino group of cylosine. the C6 attached amino group of
adenine, or the C2 attached amino group of guanine may be used as a transition metal ligand.

Ligands containing aromatic groups can be attached via acetylene linkages as is known in the art (see
Comprehensive Organfe Syntiiesis, Trost et al., Ed.. Pergamon Press. Chapter 2.4: Coupling
20 Reacttons Between sp* and sp Carbon Centers. Sonogashira, pp521-549. and pp950-953, bereb/
incorporated by reference). Structure 30 deptets a representative structure in the presence of the
metal ton and any other necessary ligands; Structure 30 depicts uridine, alttiough as for all the
structures herein, any other base may also be used.

Structure 30

25 o

!or

t. is a ligand. which may Include nitrogen, oxygen. suHur or phosphorus donating ligands (
oiganometallic ligands such as melallocene ligands. Suitable L. Hgands include, but not limited to.
phenanthfollne, Imidazole, bpyandterpy. l,and M are as defined above. Again, itwill beappredated
35 by those in the art. a Hnker(^rnsy be Included between the nucleoside and the ETM.

wo 99/57317 PCTAJS99/10104

Similarly, as for the conductive ofigomers. the linkage may l)e done using a linker, which may utilize an
amide linkage (see generally Telser et aL, J. Am. Chem. Soc. 1 1 1:7221-7226 (1989); Telser et a!., J.
Am. Chem. Soa 11 1:7226-7232 (1989), boXti of whfch are expressly incorporated by reference).
These structures are generally depicted below in Structure 31. which again uses uridine as the base.
5 although as above, the other bases may also be used:

Structures! * .

In this enibodiment. L is a ligand as defined above, with U and M as defined above as well.
15 Preferably. L is amino, phen, byp and terpy.

In a preferred embodiment, the EtM attached to a nucleoside is a metallocene; i.e. the L and of
Structure 31 are both metallocene ligands. as described above. Structure 32 depicts a preferred
embodiment wherein the metallocene is ferrocene, and the base is uridine, although other bases may
20 be used:

Structure 32

Preliminary data suggest that Structure 32 may cydize, with the second acetylene carbon atom
3 0 attacking the carbonyl oxygen, fbmiing a furan-like structure. Preferred metaltocenes include
ferrocene, cobaltocene and osnrtiumocene.

In a preferred embodiment, the ETM is attached to a n*bose at any position of the ribbse-phosphate
backbone of the nucleic acid, i.e. either the 5' or 3' terminus or any internal nucleoside. Ribose in this
35 case can include ribose anatogs. As is known in the art nucleosides that are modified at either the 2*
or 3* posrtk>n of the ribose can be made, with nitrogen, oxygen, sulfur and phosphorus-containing
nx)difications possible. Amino-modified and oxygen-modified ribose is preferred. See generally PCT

wo 99/57317 PCT/US99/I0I04
publication WO 95/15971. incorporated herein by reference. These modification groups may be used
as a transition metal iigand, or as a chemicaBy functional mbtety for attachment of other transition
metal Dgands and organometallic Hgands. oronganic electron donor moieties as will be appreciated by
those in the art In this embodiment, a linker such as depicted herein for "Z" may be used as weB, or a
conductive oligomer between the ribose and the ETM. Preferred embodiments utilize attachment at
the 2- or 3- position of the ribose, with the 2' position being preferred. Thus for example, the
conductive oligomers depicted in Structure 13. 14 and 15 may be replaced by ETMs; alternatively, the
ETMs may be added to the free tenninus of the conductive oligomer.

In a preferred embodiment, a metallocene serves as the ETM. and is attached via an amide bond as

depicted below in Structure 33. The examples outfine the synthesis of a preferred compound when
the metallocene is fenocene.

Structure 33

In a preferred embodiment, amine linkages are used, as Is generally depicted in Stmcture 34.

Structure 34.

BMSE -

Z Is a Bnker. as defined herein. With 1 -16 atoms being pfBfened. and 2^ atoms being
prefened, and t is eittter one or zero.

In a preferred embodiment, oxo Dnkages are used, » fe generally depicted in Structure 35.

wo 99/57317

PCT/US99/10104

Structure 35

In Structure 35, 2 Is a linker, as defined herein, and t is either one or zero. Prefenred Z linkers Include
alkyi groups including heteroalkyi groups such as {OH^n and (CH2CH20)n. with n from 1 to 10 being
prefen^, and n = 1 to 4 being especially preferred, and n=4 being particularly preferred.

Linkages utilizing other heteroatoms are also possible.

In a preferred embodiment, an ETM Is attached to a phosphate at any position of the ribose-phosphate
backbone of the nucleic add. This may be done in a variety of ways. In one embodiment,
phosphodiester bond analogs such as phosphoramide or phosphoramldlte linkages may be
incorporated Into a nucleic acid, where the heteroatom {l.e. nitrogen) serves as a transition metal
ligand (see PCT publication WO 95/15971, incorporated by reference). Alternatively, the conductive
oligomers depicted in Structures 23 and 24 may be replaced by ETMs. In a preferred embodiment,
the composition has the structure shown in Structure 36.

Structure 36

• •• ■ . • . . I -

In Stnjcture 361. the ETM is attached via a phosphate linkage, generally through the use of a nnker, Z.
Preferred Z linkers include alkyI groups, including heteroalkyi groups such as (CHj)^ (CH^CHjO)^ with
n from 1 to 10 being preferred, and n = 1 to 4 being especially preferred, and n=4 being particulariy
preferred.

VVhen the ETM is attached to the base or the backbone of the nudebskJe. it is possible to attach the
ETMs via "dendrimer* structures, as is more fully outlined betow. As generally depicted in Figure
37. alkyl-based linkers can be used to create multiple branching structures comprising one or more
ETMs at the terminus of each branch. Generally, this Is done by creating branch points containing

wo 99/57317 PCTAJS99/10104
multiple hydroxy groups, which optionaliy can then be used to add additional branch points. The
tenninal hydroxy groups can then be used in phosphoranHdite reactions to add ETMs, as is generally
done below for the nucleoside replacement and rhetallocene polymer reactions.

In a prefenred embodiment, an ETM such as a metallocene is used as a "nucleoside replacement*,
serving as an ETM. For example, the distance between the two cyclopentadiene rings of ferrocene is
similar to the orthongonal distance between two bases in a double stranded nucleic acid. Other
metaflocenes In addition to ferrocene may be used, for example, air stable metallocenes such as those
containing cobalt or ruthenium. Thus, metallocene moieties may be incorporated into the backbone of
a nucleic acid, as Is generally depicted in Structure 37 (nucleic acid with a ribose-phosphate
backbone) and Structure 38 (peptkie nucleic acM backbone). Structures 37 and 38 depkrt ferrocene,
although as will be appreciated by those In the art. other metallocenes may be used as weK In
general, air stable metaltocenes are preferred, including metalfocenes utilrang ruthenium and cobalt as
the metal.

Structure 37

BASE

In Stnicture 37. Z te a linker as defined above, with generally short alkyi groups, including
heteroatonre such as oxygen being preferred. Generally, what is important is the length of the linker,
such that nrtfninwrf perturbations of a double 8t^

descnlwd below. Tlius. nrethytene, ethylene, ethylene glycols, propytene and b^^
prefened. with ethylene and ethylene glycol being partknilarly preferred. In additi6r>, each 2 linker may
be the same or different Slwcture 37 depfcts a ribosei)hosphate backbond although as wiD be
appreciated by those in the art nuclete ackf analogs may also be used; indudirtg Hbose analogi and
phosphate bond analogs.

WOW57317

PCT/US99/10104

Structure 38

In Structure 38. preferred Z groups are as listed above, and again, each Z linker can be the same or
different As above, other nucleic acid analogs nnay be used as well.

In addition, although the structures and discussion above depicts metallocenes, and particularly
ferrocene, this same general idea can be used to add ETMs In addition to metallocenes, as nucleoside
replacements or in pofymer embodiments, described below. Thus, for example, when the ETIVI is a
transition metal complex other than a metallocene, comprising one. two or three (or more) ligands, the
ligands can be functionallzed as depicted for the ferrocene to allow the addition of phosphoramidite
groups. Particularly prefen-ed in this embodiment are complexes comprising at least two ring (for
example, aryl and substihjted aryl) ligands, where each of the ligands comprises functional groups for
attachment via phosphoranftJite chemistry. As will be appreciated by those in the art. this type of
reacBpn. creating polymers of ETMs either as a porfion of the backbone of the nucleic acid or as 'side
grouf^" of the nuclefc acWs, to allow amplificatfon of the signals generated herein, can be done with
virtually any ETM that can be functionanzed to contain the correct chemical groups.

Thus, by inserting a metallocene such as ferrocene (or other ETM) Into the backbone of a nucleic acW,
nudeic add analogs are made; that is. the invention provides nudefc adds having a backbone
comprising at least one metallocene. This is distinguished from nucleic adds having metallocenes
attached to the backbone, i.e. via a nlxDse. a phosphate, etc. That is. two nudeic adds each made up
of a traditional nudeic add or analog (nucleic acWs In this case induding a single nudeoside). may be
covalenHy attached to each other via a metallocene. Viewed differently, a metenocene derivative or
substituted metaDocene is provided, wherein each of the two aromatic rings of the metaflocene has a
nudeic add substitutent group.

wo 99/57317 PCT/OS»n0104
liraddition. as is more fully outlined below, it is possible to incorporate more than oiie metallocene into
the backbone, either with nucleotides in between and/or with adjacent metattocenes. When adjacent
metallocenes are added to the backbone, this is sirriHar to the process described below as
"metalkwene polymers"; that is. there are areas of metallocene polymers within the backbone.

In addition to the nucleic acid substitutent groups, it is also desirable in some instances to add
additional substituent groups to one or both of the aromatic rings of the metaltocene (or ETM). For
example, as these nucleoskie replacements are generally part of probe sequences to be hybridized
with a substantially complementary nuclefc add, for exannple a target sequence or another probe
sequence, it is possible to add substitutent groups to the metaltocene rings to facilitate hydrogen
bonding to the base or bases on the opposite strand. These may be added to any position on the
metaltocene rings. Suitabte substitutent groups Include, but are not limited to. amide groups, amine
groups, carboxylto acids, and atoohois. including substituted ateohols. In addition, these substitutent
groups can be attached via linkers as well, although in general this is not preferred.

In addition, substituent groups on an ETM. particulariy metattocenes such as ferrocene, may be added
to alter the redox properties of the ETIW. Thus, for example, in some embodiments, as is more fuHy
described betow, it may be desirable to have different ETMs attached in different ways (i.e. base or
ribose attachment), on different probes, or for different purposes (for example, calibration or as an
Intemal standard). Thus, the additton of substituent groups on the metallocene may allow two different
ETMs to be dtetingulshed.

In order to generate these metaltocene4)ackbone nudek: acM analogs, the intermediate components
are also provided. Thus, in a prefened embodlmenl. the im/entton provides phosphoramMlte
metanocenes, as generally deptoted in Structure 39: •

Strudure39

PG — o

2-— AROMjTICRIN
M

z-^aromAhcrin

NCfiCHjC P N^j.^^^

CH,

wo 99/57317 PCT/US99A10104

In Stojcture 39. PG is a protecting group, generally suitable for use in nucleic acid synthesis, with
DMT, MMT and TMT all being preferred. The aromatic rings can either be the rings of the
metallocene, or aromatic rings of ligands for transition metal complexes or other organic ETMs. The
aromatic rings may be the same or different, and may be substituted as discussed herein.

Structure 40 depicts the ferrocene derivative:

Structure 40

NCH2CH2C- — p — N-^^^-^

These phosphoramidite analogs can be added to standard oligonucleotide syntheses as is known in
the art

Structure 41 depicts the ferrocene peptide nucleic acid (PNA) monomer/ that can be added to PNA
synthesis (or regular protein synthesis) as is known in the art and depicted within the Figures and
Examples:

Structure41

PG— NH

-0

In Structure 41/the PG protecting group is suitable for use in peptide nucleto acid synthesis, with
MMT, boc and Fmoc being preferred;

These same intermediate compounds can be used to form ETM or metaliocene polymers, whfch are
added to the nuclefc adds, rather than as backbone replacements, as is more fully descn"bed betow.

wo 99/57317 PCT/US99/10104

In a preferred embodiment, the ETMs are attached as polymers, for example as metallocene
polymers, in a "branched" configuration similar to the "branched DNA" embodiments herein and as
outitned in U.S. Patent No. 5,124,246. using modified functionalized nucleotides. The general idea is
as follovKS. A modified phosphoramidlte nucleotide is generated that can ultimately contain a free
5 hydroxy group that can be used in the attachment of phosphoramidlte ETMs such as metallocenes.
This free hydroxy group could be on the base or the backbone, such as the ribose or the phosphate
(although as will be appreciated by those in the art, nucleic acid analogs containing other structures
can also be used). The modified nucleotide is incorporated into a nucleic acid, and any hydroxy
protecting groups are removed, thus leaving the free hydroxyl. Upon the addition of a

1 0 phosphoramidlte ETM such as a metallocene, as described above in structures 39 and 40, ETMs,

such as metallocene ETMs, are added. Additional phosphoramidlte ETMs such as metallocenes can
be added, to fonm "ETM polymers", including "metallocene polymers" as depicted in Figure 36 with
ferrocene, in addition, in some embodiments, it is desirable to increase the solubility of the polymers
by adding a "capping" group to the temnlnal ETM in the polymer, for example a final phosphate group

15 to the metallocene as is generally depicted in Figure 36. Other suitable solubility enhancing "capping"
groups will be appreciated by those in the art It should be noted that these solubOity enhancing groups
can be added to the polymers in other places, including to the ligand rings, for example on the
metallocenes as discussed herein

20 A preferred embodiment of this general idea is outlined in the Figures. In this embodiment, the 2*
position of a ribose of a phosphoramidlte nucleotide is first functionalized to contain a protected
hydroxy group, in this case via an oxo*linkage, although any number of linkers can be used, as is
generally described herein for Z linkers. The protected modified nucleotkle is then incorporatisd via
standard phosphorarmdite chemistry into a growing nucleto acid. The protecting group is removed,

2 5 and the free hydroxy group is used, again using stendard phosphoramidlte chemistry to add a

phosphoramidlte metallocene such as ferrocene. A similar reactfon is possible for nucleic add
analogs. For example, using peptide nucleic acids and the metallocene monoher shown in Structure
41, peptide nucleic ackJ structures containing metaltocene polyniers could be generat^^

3 0 Thus, the present invention provides recruitment linkers of nucleic acids comprising "branches" of

metaltocene polymers as is generally depicted in Figures 36 and 37. Prefen-ed embodiments also
utilize metaltocene polymers from one to about 50 metallocenes in length, with from about 5 to about
20 being preferred and from about 5 to about 10 being espe^^^

35 In addltbri, when the recmitment linker is nucleic add, any combinafion of ETM attadinr^ents may be . .
done.

wo 99/57317 PCTAJS99/10104
In a preferred embodiment, the recruitment Knker is rtot nucleic add. and instead may be any sort of
linker or polymer. As will be appreciated by those in the art, generally any linker or polymer that can be
niodified to contain ETMs can be used. In general, the polymers or linkers should be reasonably
soluble and contain suitable functtonal groups for the addition of ETMs.
5 ' . . .

As used herein, a "recruitment polymer* comprises at least two or three subunits, which are covalently
attached. At least some portion of the monomeric subunits contain functional groups for the covalent
attachment of ETMs. In some embodiments coupling moieties are used to covalently link the subunits
with the ETMs. Preferred functional groups for attachment are amino groups, carboxy groups, oxo
10 groups and thiol groups, with amino groups being particularly preferred. As will be appreciated by
those in the art a wide variety of recruitment polymers are possible.

Suitable linkers include, but are not limited to, alkyi linkers (Including heterpalkyl (including
(poIy)ethylene glycoktype structures), substituted alkyI, aryalkyi linkers, etc. As above for the
15 polymers, the linkers will comprise one or more functional groups for the attachment of ETMs. which
will be done as will be appreciated by those in the art, for example through the use homoK>r hetero-
bifunctional linkers as are well known (see 1994 Pierce Chemical Company catalog, technical section
on cross-linkers, pages 155-200, Incorporated herein by reference).

20 . Suitable recruitment polymers Include, but are not limited to, functionalized styrenes, such as amino
styrene, functionalized dextrans, and polyamino acids. Preferred polyniers are polyamino acids (both
poly-Oamino acWs and po!y-L-amino acids), such as polylysine. and polymers containing lysine and
ottier amino acids being particularly preferred. Other suitable polyamino ackJs are polygliitamic add.
polyasparBc acid, co-polymers of lysine and glutamic or aspartic acid, co-polymers of lysine with

2 5 alanine, tyrosine, phenylalanine, serine, tryptophan, and/or proline.

In a preferred embodiment, the recruitment linker comprises a metallocene polymer, as is described
above..

3 0 The attachment of ttie recruitment Dnkers to eitiier the solution binding ligand or the first portion of \he

label probe will depend on the composition of the recruitment linker and of the label and/or binding
ligand, as will be appreciated by ttiose in the art When eitf^er ttie label probe or the binding ligand Is
nucleic acU, nuctefc add recruitment linkers are generally fomrted during the synthesis of the first
spades, with incorjx>rafion of nucleosides containing ETMs as required. Altematively , the first portion
35 of the bbel probe or the binding ligand and the recruitment linker may be made separately, and then .
attached. When they are botti nuclefc add; there may be an overtapping section of complenrientarity,

wo 99/57317 PCT/US99/10104

fbrmrng a section of douWe stranded nucleic add ttiat can then be chemically crosslinlwd, for example
by using psoralen as is known in the ait .

When non-nucleic acid recruttmerit linkers are used, attachment of the Hnker/polymer of the
recruitment linker will be done generally using standard chemical technkjues, such as will be .
appreciated by those in the art For example, when alkyl-based linkers are used, attachment can be
similar to the attachment of insulators to nuciete adds.

In addjtfon. it is possible to have recruitment linkers that are mixtures of nucleic acids and non-nucleic
adds, either in a Rnear fomi (i.e. nuciek: add segments linked together with alkyi linkers) or in
branched fonns (nudefc adds with all^l "branches" that may contain ETMs and may be additionally
branched).

It is also possible to have ETMs connected to probe sequences, i.e. sequences designed to hybridize
to complementary sequences. Thus. ETMs m^ be added to non-recruitment linkers as well. For
example, there may be ETMs added to sections of label probes that do hybridize to components of the
assay complex, for example the first portfon, or to the target sequence as outlined above and depkrted
In Figure 39R. These ETMs may be used for electron transfer detection in some embodiments, or
they may not depending on the tocation and system. For example, in some embodiments, when for
^mple the target sequence containing randomly incorporated ETMs is hybridized directly to the
capture probe, as is deptoted In Figure 38A and 39B, there may be ETMs in the portfon hybridizing to
the capture probe. If the capture probe is attached to the electrode using a conductive digomer. these
ETMs can be used to deted electron transfer as has been prevfously described. AKemaBvely, these
. ETMs rhay not be specifically detected. -

Similarty, in some embodiments, when the recruitment linker is nudeic add, it may be desirable in
some instances to have some or all of the recruitment linker be double stranded. In one embodiment,
there may be a second recruitment linker, substanttally complementary to the first recmilment nnker,
that can hybridize to the first recruitment linker. In a preferred embodiment the first recnjitment linker
comprises the covalently attached ETMs . In an alternative embodiment, the seoorid recruitment linker
contains the ETMs, and the first recruilment linker does not. and the ETMs are recruited to the surface
byhybridizatfonofthesecondrecnjitnwntnntertothefirsL In yet another embodiment, both the first
and second recruitment Hnkers comprise ETMs. It should be noted, as dtscossed above, that nudeic
adds comprising a large number of ETMs may not hybridize as weH. Le; the T„ may be decreased,
depending on the site of attachment and the charaderistks of the ETM. Thus. In genera^^ .
multiple ETMs are used on hybridizing strands, generally there are less than about 5. with less than

wo 99/57317 PCT/US99/10104

about 3 being preferred, or aitemativery the ETMs should be spaced sufficiently far apart that the
intervening nucleotides can sufficiently hybridize to allow good kinetics.

In one enibodinnent, when nticleic acid targets and/or binding ligands and/or recruitment linkers are
used, non-covalently attached ETMs may be used. In one embodiment the ETM is a hybridization
indicator. Hybridization indicators serve as an ETM that will preferentiaily assodate with double
stranded nucleic acid is added, usually reversibly, similar to the npiethod of Millan et al., Anal. Chem.
65:2317-2323 (1993); Millan et a!., Anal. Chem. 662943-2948 (1994), both of which are hereby
expressly incorporated by reference. In this embodiment, increases in the local concentration of
ETMs, due to the association of the ETM hybridizatfon indicator with double stranded nuciek: acid at
the surface, can be monitored using the monolayers comprising the conductive oligomers.
' Hybridization indicators include intercalators and minor and/or major groove binding moieties. |n a
preferred embodiment intercalators may be used; since intercalation generally only occurs In the
presence of double stranded nucleic acid, only in the presence of double stranded nucleic acid will the
ETMs concentrate. Intercalating transitton metal complex ETMs are known in the art Similariy, major
or minor groove binding nroieties, such as methylene blue, may also be used in this embodiment

Similariy. the systems of the inventfon may utilize non-covalently attached ETMs, as is generally
described in Napier et al.. Bioconj. Chem. 8:906 (1997). hereby expressly incorporated by reference.
In this embodiment changes in the redox state of certain molecules as a result of the presence of
DMA (i.e. guanine oxidation by ruthenium complexes) can be detected using the SAMs comprising
conductive oligomers as well.

Thus, the present invention provkfes electrodes comprising monolayers comprising conductive
oHgomers, generally including capture binding ligands. and either binding ligands or label probes that
will bind to the binding ligands conriprising recmitnrient linkers containing ET^

In a preferred embodiment the compositions of the inventtoh are used to detect target analytes in a
sample. In a preferred embodiment the target analyte is a nucleic add, and thiis detection of target
sequences is done. The term "larget sequence" or grammatical equivalents herein means a nucleic
add sequence on a single strand of nudefc add. The target sequence may be a portion of a gene, a
regulatory sequence, genomic DNA, cDNA. RNA Induding mRNA and rRNA, or others. It may be any
length, witti the understanding tiiat longer sequences are more spedfic. As wifl be appreciated by
those in the art ttie complementary target sequence may take many fonns. For exan^e, it may be
contained witiiin a larger nudefc add sequence, i.e. an or part of a gene or mRNA, a restriction
fr^ment of a plasmki or genontic DUA, among others. As is outiined more fuDy betow, probes are
made to hybridize to target sequences to determine tfie presence or absence of ttie target sequence in

wo 99/57317 PCT/US99/10104
a sample. Generally speaking, this term win be understood by those skilted in the art. Tbe target
sequence may also be comprised of different target domains; for example, a first target domain of the
sample target sequence may hybridize to a capture probe or a portion of capture extender probe, a
second target domain may hybridize to a portion of an amplifier probe, a label probe, or a different
capture or capture extender probe, etc. The target domains may be adjacent or separated. The terms
"firsr and "second" are not meant to confer an orientation of the sequences with respect to the 5'-y
orientation of the target sequence. For example, assuming a 6'-3* orientation of the complementary
target sequence, the first target domain may be located either 5* to the second domain, or 3* to the
second domain.

If required, the target analyte is prepared using known technfc|ues. For example, the sample may be
treated to lyse the cells, using known lysis buffers, eleclroporatlon, ete.. with purlficatfon occuring as
needed, as will be appreciated by those In the art In a preferred embodiment, when the target analyte
is nucleic acid, amplification may be done, including PGR and other amplification techniques as
outlined In PCT US99/01705. incorporated herein by reference in Its entirety.

When the target analyte is a nucleic acid, probes of the present Invention are designed to be
complementary to a target sequence (either the target sequence of the sample or to other probe
sequences, as is described below), such that hybridizatfon of the target sequence and the probes of
the present inventton bcoirs. As outlined below, this complementarity need not be perfect; there may
be any number of base pair mismatches which WB interfere with hybridization between the target
sequence and the single stranded nucleic adds of the present Invention. However. If the number of
mutattons Is so great that no hybridizatfon can occur under even the least stringent of hybridization
conditions, the sequence is not a complementary target sequence. Thus, by "substantial^
complementary" herein is meant that the probes are sufficiently complenfienta^
sequences to hybridize under normal reaction conditfons.

Generally, the nucleic acid compositions of the invention are useflil as oligonucleotide probes. As Is
appredated by tiiose In the art, the lengtii of ttte probe will vary witti ttie lengtti of the target sequence
and the hybridization and wash conditions. Qenerally, oligonucleotide probes range from about 8 to
about 50 nucleotides, with froifn about 10 to about 30 being preferred and fix>m about 12 to about 25
being espedally prefenred. In some cases, very long probes may be used. e.g. 50 to 200-300
nucleotides in lengtti. ^us, in ttie structures depk:ted herein, nucleosides may be replaced witti
nudeicackis.

A variety of hybridization conditions rnay be used in ttie present invention, induding high, moderate
and low stringency conditions: see for example Maniatis et al., Molecular Cloning: A Laboratory

wo 99/57317 PCT/US99/jl0104
Manual, 2d Editbh, 1989, dhd Short Protobois Tn Molecular Biology; ed. Ausubel. et at, hereby
incorporated by referenece. The hybridization conditions may also vary when a non-ionic backbone,
i.e. PNA is used, as is known in the art In addition, cross-linking agents may be added after target
binding to cross-link, |.e. covalently attach, the two strands of the hybridtzatton complex.

-5

As will be appreciated by those in the art, the nucleic acid systems of the invention may take on a
large number of different configurations, as is generally depicted in the figures. In general, there are
three types of systems that can be used: (1 ) systems in which the target analyte itself is labeled with
ETMs (i.e. the use of a target analyte analog, for non-nucleic acid systems, or, for nucleic acid

10 systems, the target sequence is labeled; see Figures 6A, 6B and 6C); (2) systems in which label
probes (or capture binding ligands with recruitment linkers) directly bind (i.e. hybridize for nudete
adds) to the target analytes (see Figures 6D-6H for nucleic acid embodiments and Figure 2A and 2C
for non-nucleic add embodiments); and (3) systems in which label probes comprising recruitment
lihkiers are indirectly bound to the target analytes, for example through the use of amplifier probes (see

15 . Figures 61, 6 J and 6K for nucleic acid embodiments and Figure 28 and 2D for non-nudeic add
embodiments).

In all three of these systems, it is preferred, although not required, that the target analyte be
immobilized on the electrode surface. This Is preferably done using capture binding ligands and

20 optionally one or more capture extender ligands. When only capture binding ligands are utilized, it is
necessary to have unique capture binding ligands for each target analyte; that is, the surface must be
customized to contain unique capture binding ligands. Alternatively, the use of capture extender
ligands. partfoulariy when the capture extender ligands are capture extender probes (i.e. nudeic adds)
may be used, that altow a "universar surface, i.e. a surface containing a single type of capture probe

25 that can be used to detect any target sequence.

Capture extender probes or moieties may take on a variety of different conformations, depending on
the identity of the target analyte and of the binding ligands. In a preferred embodiment, ttie target
analyte and the binding ligand are nudeic acids, in this embodiment, the "capture extender' probes

30 are generally depicted in Rgure 6 and have a first portton that will hybridize to all or part of the capture
prot)e, and a second portion that will hybridize to a portion of the target sequence. This then allows
the generation of customized soluble probes, which as will be appredated by those in the art is
generally simpler and less costly. As shown herein (e.g. Rgure 6H). two capture extender probes may
be used. This has generally t)een done to stabilize assay complexes (for example when the target

35 sequence is large, or when large ampBlier probes (particularly branched or dendrimer amplifier
prot>es) are used. .

wo 99/57317 PCT/US99/10104
When the capture binding Itgand is not a nucleic add. capture extender components may still be used
In one embodiment, as depicted in Figure 2C, the capturis binding ligand has an associated capture
extender of nucleic acid (although as will be appreciated by those In the art, it could be part of a
binding pair as well), that can be used to target to the electrode surface. Altematively, an additional
capture extender component can be used, to allow a "generic" surface (see Figure 1).

In a preferred embodiment, the capture binding ligands are added after the fbnmation of the SAM ((4)
above)* This may be done in a variety of ways, as will be appreciated by those in the art. In one
emt)Odiment, conductive oligomers with terminal functional groups are made, with prefen-ed
embodiments utifeing activated carboxylates and isothlocyanates. that will react wlUi primary amines
that are put onto \he binding ligand. as is generally depicted in Figure 7 using an activated carboxylate
and nucleic acid, although other capture ligands may be attached in tills way as well/ These two
reagents have the advantage of being stable in aqueous solution, yet read witti primary alky lamines.
This allows the spotting of probes (either capture or detection probes, or botti) using known methods
(ink jet. spotting, etc.) onto ttie surface.

In addition, tiiere are a number of non-nucleic acid metfiods ttiat can be used to immobilize a capture
binding ligand on a surface. For example, binding partner pairs can be utilized; i.e. one binding
partner is attached to tiie terminus of ttie conductive oligomer, and ttie other to Uie end of the binding
Bgand. This may also be done wfthout using a nucleic acid capture probe; that Is, one binding partrier
sierves as ttie capture probe and tiie ottier Is attached to eittier ttie target sequence or a capture
extender probe. That fe, elttier ttie target sequence comprises the binding partner, or a capture
extender probe tiiat will hybridize to ttie target sequence comprises ttie binding partner Suitable
binding partner pairs include, but are not limited to. hapten pairs such as biotin/streptavldln;
antigens/antibodies; NTAmisb'dine togs; etc. In general, smaller binding partners are preferred.

In a preferred embodiment, when ttie torget sequence itself is modified to contain a binding partner,
ttie tM*ndinj3 partner \s attoched via a modified nucleotide ttiat can be enzymatically attached to ttie
target sequence, for example during a PCR target ampDficatton st^p. Altematively. tiie bindirig partner
shouM be easily attached to ttie target sequence.

AHemafively. a capture extender probe may be uttiized ttiat ha^ a hudek: add portion for hybridlzatibn
to ttie target as well as a. binding partner (for exampte, ttie capture extender probe may comprise a
non-nudeic add portion such as an alkyi linker ttiat is used toa^ Inttiis
embodiment, it may be desirable to cross-link ttte double-stranded nucleic add of ttie target and
capture extender probe for stability, for example using psoralen as is known In ttie art!

wo 99/57317 PCT/US99/10104

In one embodiment, the target is not bound to the electrode surface using capture binding ligands. In
this embodfinent, what is important, as for all the assays herein, is that excess label probes be
removed prior to detection and that the assay complex (comprising the recruitment linker) be in
proximity to the surface. As will be appreciated by those In the art, this may be accomplished in other
5 ways. For example, the assay complex may be present on beads that are added to the electrode

compirising the monolayer. The recruitment linkers comprising the ETMs may be placed in proximity to
the conductive oligomer surface using techniques well known In the art, including gravity settling of the
beads on the surface, electrostatic or magnetic Interactions between bead components and the
surface, using binding partner attachment as outlined above. Alternatively, after the removal of excess
10 reagents such as excess label probes, the assay complex may be driven down to the surface, for
example by pulsing the system with a voltage sufficient to drive the assay complex to the surface.

However, preferred embodiments utilize assay complexes attached via capture binding Iigands.

15 For nucleic acid systems, a preferred embodiments utilize the target sequence itself containing the
ETMs. As discussed above, this may be done using target sequences that have ETMs Incorporated
at any number of positfons. as outlined above. Representative examples are depfcted in Rgures 6A,
6B and 6C. In this embodiment as for the others of the system, the 3*-5' orientation of the probes and
targets is chosen to get the ETM-containing structures (I.e. recruitment linkers or target sequences) as

20 close to the surface of the monolayer as possible, and in the conwt orientation. This may be done
using attachment via insulators or conductive oligomers as is generally shown In the Rgures. In
addition, as will be appreciated by those in the art multiple capture probes can be utilized, either in a
configuration such as depicted in Figure 6C, wherein the 5*-3' orientation of the capture probes is
different or when3 "loops" of target fbmn when multiples of capture probes as depicted In Figures 6A

25 and 6B are used.

For nucleic add systems, a preferred embodiments utilize the label probes directly hybridizing to the
target sequences, as is generally depicted in Fgures 6D - 61. In these embodiments, fte target
sequence Is preferably, but not required to be, immobireed on the surface using capture probes.

30 including capture extender probes. Label probes are then used to bring the ETMs into proximity of the
surface of the monolayer comprising conductive oligomers. In a prefenred embodiment multiple tabel
probes are used; that is, label probes are designed such that the portion that hybridizes to the target
sequence (labeled 41 in the figures) can be different for a number of different label probes; such that
amplificatfon of the signal occurs, since multiple fabel probes can bind for every target sequence.

35. Thus, as depicted in the figures, n is an Integer of at least one. Depending on the sensitivity desired,
the tength of the target sequence, the number of ETMs per label probe, etc.. preferr^ ranges of n are
from 1 to 50, with from about 1 to about 20 being partlcutarty preferred, and from about 2 to about 5

WO 99/57317 PCi7US99/10104
being espedally preferred. In addition. If "generic- label probes are desired, label extender probes
can be used as generalV described bekw fior use with amplifier probes.

As above, generally In this embodiment the configuration of the system and the label probes
(recruitment linkers) are designed to recmit the ETMs as dose as possible to the monolayer surfaca

In a prefen-ed embodiment, the label probes are bound to the target analyte fridirecUy. That Is, the
present invention finds use in novel combinations of signal amplification technologies and electron
transfer detection on electrodes, w^hich may be particulariy useful in sandwich hybridization assays, for
nucleic acid detection, as generally depicted in Figures 61 et seq. In these embodiments, the amplifier
probes of the Invention are bound to the target sequence in a sample either directly or indirectly.
Since the amplifier probes prefierably contain a relatively large number of ampHficaSon sequences that
are available for binding of label probes, the detectable signal is significantly increased, and allows the
detection limits of the target to be significantly improved. These label and amplifier probes, and the
detection methods described herein, may be used in ^ntially any known nucleic acM hytmdizafion
fomnats. such as those in which the target is bound directly to a solid phase or in sandwich
hybridizatton assays in «^ich the target is bound to one or more nuctek: ackis that are in turn bound to
the solid phase.

20 . In general, these embodiments may be described as foltows. An amplifier probe is hybridized to the
target sequence, either directly (e.g. Figure 61). or through the use of a label extender probe (e.g.
Figure 6N and 60). whfch serves to aUow "generic" amplifier probes to be made. The target sequence
Is preferably, biit not required to be. immobilized on the electrode using capture probes. Preferabty,
the amplifier probe contains a multiplk% of ampHfkstkm sequences, although In some embodiments,

25 as described betow, the amplifier probe may contain only a single ampBftoatton sequence. The

amplifier probe may take on a number of different fornis; either a branched confbrmatkMi, a dendrimer
confbmration, or a linear "string" of amplifkatfon sequences. These ampliftoatkm sequences ire used
to fbmi hybridizatfon complexes with label probes, and the ETMs can be detected using the eiectrpde.

3 0 Accordingly, the present invention provides assay complexes cbmprising at least one amprrfier prbbe. .
By -amprifier probe" or "nuclefe acid multimer" or "amplification multimer" or grammatical equivalents
herein Is nteant a nuctefcacM probe that is used to faalitate signal ampl^^^ Amplifier pn>bes
comprise at least a first single^nded nudeie acid probe sequence, as defined below, and at lek
one slngle-stranded nudeie add amplifieatton sequence, with a multiplicity of ampllficatfon sequences

35 being pref^ned. In some embodiments, it is possible to use amplifier binding ligands. that are non-

nudefc add based but that comprise a plurality of binding sites for the later assodationArfhding of label

wo 99/57317 PCT/US99/10104

ligands comprising recruitment linkers. However, amplrfier probes are preferred In nucleic acid
systems.

Amplifier prol)es comprise a first probe sequence that is used, either directly or indirectly, to hybridize
to the target sequence. That is, the amplifier probe itself may have a first probe sequence that is
substantially complementary to the target sequence (e.g. Rgure 61). or it has a first probe sequence
that is substant'ally complementary to a portion of an additional probe, in this case called a label
extender probe, that has a first portion that is substantially complementary to the target sequence (e.g.
Figure 6N). In a prefen-ed embodiment, the first probe sequence of the amplifier probe is sut^tantially
complementary to the target sequence, as is generally depicted in Figure 61.

In general, as for all the probes herein, the first probe sequence is of a length sufficient to give
specificity and stability. Thus generally, the probe sequences of the invention that are designed to
hybridize to anothei- nucleic acid (i.e. probe sequences, amplification sequences, portions or domains
of larger probes) are at least about 5 nucleosides long, with at least about 10 being preferred and at
least about 1 5 being especially preferred.

In a prefen^d embodiment, as is depicted in Figure 8, the amplifier probes, or any of the other probes
of the invention, may fbnn hairpin stem-loop structures In the absence of their target. The length of the
stem double-stranded sequence will be selected such that the hairpin structure is not favored In the
presence of target. The use of these type of probes, in the systems of the invention or In any nucleic
acid detection systems, can result in a significant decrease in non-specific binding and thus an
increase in the signal to noise ratio.

Generally, these hairpin structures comprise four components. The first component is a target binding
sequence, l.e. a region complementary to the target (which may be the sarnple target sequence or
another probe sequence to which binding is desired), that is about 10 nucleosides long, with about 15
being preferred. The second component is a loop sequence, that can facilitate the fbrmafion of nudelc
add loops. Particulariy preferred in this regard are repeats of GTC. which has been kJehtified in
Fragile X Syndn^me as fbnning turns. (When PNA analogs are used, turns comprising proline
residues may be prefenred). Generally, from three to five repeats are used, with four to five being
preferred. The third component is a seIfKX)mplementary region, which has a first port^^
complementary to a portion of the target sequence region and a second portion that comprises a first
portion of the label probe binding sequence. The fourth component is substantially complementary to
a label probe (or other probe, as the case may be). The fourth component further comprises a •sficky •
emr, that te, a portion that does not hybridize to any other portion of the probe, and preferably
contains most if not an. of the ETMs. The general structure is depicted in Figure 38. As will be

wo 99/57317 PCT/US99/10104
appFBciated by those In the art. the any or all of the proberdsscribed herein may be configured to
form hairpins in the absence of their targets. Including the amplifier, capture, capture extender, label
and label extender probes.

In a preferred embodiment, several different amplifier probes are used, each with first probe
sequences that will hybridize to a different portion of the target sequence. That is. there is more than
one level of amplification; the amplifier probe provides an amplification of signal due to a multiplicity of
labelling events, and several different amplifier probes, each wfth this multipiicity of labels, for each
target sequence is used, thus, preferred embodiments utilize at least two different pools of amplifier
probes, each pool having a different probe sequence for hybridization to different portions of the target
sequence: the only real limitation on the number of different amplifier probes will be the length of the
original target sequence. In addition, it Is also possible that the different amplifier probes contain
different amplification sequences, although this Is generally not preferred.

In a prefened embodiment the amplifier probe does not hybridize to the sample iarget sequence
directly, but instead hybridizes to a first portion of a label extender probe, as is generally depicted in
Figure 39L This is particulariy useful to allow the use of "generic* amplifier probes, that Is. amplifier
probes that can be used with a variety of different targets. This may be desirable since several of the
Smplilier probes require special synthesis techniques. Thus, the addition of a relatively short probe aS
a label extender probe is preferred. Thus, the first probe sequence of the amplifier probe is
substantially complementary to a first portion or domain of a first label extender single-stranded
raicteic acid probe. The label extender probe also contains a second portion or domain that is
substantially complementary to a portion of the target sequence. Both of these portions are preferably
at least about 10 to about 50 nucleotides in tength. with a range of about 15 to about 30 being
preferred. The temis "firsT and "second" are not meant to confer an orientation of the sequences with
respect to the 5'-3' orientation of the target or probe sequences. For example, assuming a 5'^'
orientation of the complementary target sequence, the first portion may be located either 5- to the
second portion, or 3' to the second portion. For convenience herein, the order of probe sequences are
generally shown from left to right

In a preferred embodiment more than one label extender probe-amplifier probe pair may be used, tht

ls,nls more thanl That ls.aplurality of tebel extender probes may be used, each withaportion^m^^^
is substantblly comptementary to a different portion of the target sequence; ths can serve as another
tevei of amplification. Thus, a preferred embodiment utilizes pools of at least two label extender
probes, with the upper limit being set by the tength of the target sequence.

wo 99/57317 PCT/US99/10104
\n a preferred embodiment, more than one label extender probe is used with a single amplifier probe to
reduce non-specific, binding, as is depicted in Figure 60 and generally outlined in U.S. Patent No;
5,681 .697, incorporated by reference herein. In this embodiment, a first portion of the first label
extender probe hybridizes to a first portion of the target sequence, and the second portion of the first
label extender probe hybridizes to a first probe sequence of the amplifier probe. A first portion of the
second label extender probe hybridizes to a second portion of the target sequence, and the second
portion of the second label extender probe hybridizes to a second probe sequence of the arhplifier
probe. These form structures sometimes referred to as "cruciform" structures or configuriations. and
are generally done to confer stability when large branched or dendrimeric amplifier probes are used.

In addition, as will be appreciated by .thos6 in the art the label extender probes may interact with a
preamplifier probe, described below, rather than the amplifier probe directly.

Similarly, as outlined above, a prefen-ed embodiment utilizes several different amplifier probes, each
15 with first probe sequences that will hybridize to a different portion of the label extender probe. In
addition, as outlined above, it is also possible that the different amplifier probes contain different
aniplrfication sequences, although this is generally not preferred.

In addition to the first probe sequence, the amplifier probe also comprises at least one amplification
20 sequence. An "amplification sequence' or "amplification segment" or grammatical equivalents herein
Is meant a sequence that is used, either directly or indirectly, to bind to a first portion of a label probe
as is more fully described below. Preferably, the amplifier probe comprises a multiplicity of
amplificafion sequences, with ft^m about 3 to about 1000 being prefenred. from about 10 to about 100
being partlcularty prefen^, and about 50 being especiaily preferred. In some cases, for example
25 when linear amplifier probes are used, from 1 to about 20 Is preferred vwth from about 5 to about 10
t>eing particulariy preferred. Again, when non-nucleic acid amplifier moieties are used, the
amplification segnnent can bind label ligands.

The amplification sequences may be linked to each other in a variety of ways, as will be appreciated
30 by those in the art They may be covalently linked directly to each other, or to intervening sequences
or chemical moieties, through nucleic add linkages such as phosphodiester bonds. PNA bonds, etc.,
or through Interposed linking agents such amino acW, carbohydrate or polyol bridges, or through other
cross-linking agents or binding partners. The site(s) of linkage may be at the ends of a segment
and/or at one or more mtemal nucleotides in the strand. In a preferred embodiment the amplification
35 sequences are attached via nucleic ackl linkages.

wo 99/57317 PCT/US99/i0104
In a preferretf embodiment, branched amplifier probes are used, as are generaly described fti U.S. .
Patent No. 5,124.246. hereby Incorporated by reference. Branched amplifier probes may take on
"fbrk-lik©T or "comb-like" conformations. "Fork^ike" branched amplifier probes generally have three or
more oligonucleotide segments emanating from a point of origin to torn a branched structure! The
point of origin may be another nucleotide segment or a multifunctional molecule to whclh at least three
segments can be covalently or tighUy bound. "Comb-like" branched amplifier probes have a linear
backbone with a multiplicity of sidechain oligonucleotides extending from the backbone. In either
conformation, the pendant segments will nomially depend from a modified nucleotide or ottier organic
moiety having the appropriate functional groups for attachment of oligonucleotides. Furthermore, in
either confbmiatlon. a large number of amplificatfon sequences are available for binding, either directly
or indirectly, to detection probes. In general, these structures are made as is known in the art, using
iTKKJilied multifunctional nucleotWes, as is described in U.S. Patent Nos. 5,635,352 and 5,124.246.
aniong others.

In a preferred embodiment, dendrimer amplifier probes are used, as are generally described in U.S.
Patent No. 5.175.270. hereby expressly incorporated by reference. Oendrimerto amplifier probes have
amplification sequences that are attached via hybridization, and thus have portions of double-stranded
nucleic acid as a component of their structure. The outer suriace of the dendrimer amplifier probe has
a multiplicity of amplifk»tk>n sequences.

In a preferred embodiment, nnear ampliffer probes are used, that have indivWual amplificat^^
sequences linked end-to^nd either directly or with short intervening sequences to forih a polymer. As
with the other amplifier configuratfons, there may be addHkmal sequences or mofetfes between the
amplification sequences. In addition, as outToied herein, linear amplificalion probes may form hairpin
stem-kwp structures, as is depteted in Figure 8.

In one embodiment, the linear amplifier probe has a single ampnffcation sequence. This itray be u^ful
when cycles of hybridization/disassociation occurs, fomiing a pool of amplifier probe that vras
hybridized to the target and then removed to altow more probes to bind, or when large numbers of
ETMs are used for each label probe. However, in a preferred embodiment, linear ampTifier probes ^
comprise a inultq>lici^ of amplificatton sequences.

In addltton. the amplifier probe may be totally linear, tolalV b^
combinatkMi thereof.

The amplification sequences of the amplifier probe are used, either directly or Indirectly, to bind to a
label probe to allow detectkMt. In a preferred embodiment the ampBficatton sequences of the

WOW57317 PCT/US99/10104

amplifier probe are substantially complementary to a first portion of a label probe. Alternatively,
amplifier extender probes are used, that have a first portion that binds to the amplification sequence
and a second portion that binds to the first portion of the label probe.

In addition, the compositions of the iiiventlon may include "preamplifier* molecules, which serves a
bridging nwiety between the label extender molecules and the amplifier probes. In this way, more
amplifier and thus more EtMs are ultimately bound to the detection probes. Preamplffier molecules
may be either linear or branched, and typically contain in the range of about 30-3000 nucleotides.

The reactions outlined below may be accomplished in a variety of ways, as will t>e appreciated by
those in the art Components of the reaction may be added simultaneously, or sequentially, in any
order, with preferred embodiments outlined below. In addition, the reaction may include a variety of
other reagents may be included In the assays. These include reagents like salts, buffers^ neutral
proteins, e.g. albumin, detergents, etc which may be used to facilitate optimal hybridization and
detection, and/or reduce non-specffic or background interacttons. Also reagents that otherwise
improve the efficiency of the assay, such as protease inhibitors, nuclease inhibitors, anti-microbial
agents, etc., may be used, depending on the sample preparatfon methods and purity of the target

Generally, the methods are as follows. In a preferred embodiment, the target is initially imniobilized or
attached to the electrode. For nucleic acids, this is done by fonning a hybridization complex between
a capture probe and a portion of the target sequence. A preferred embodiment utilizes capture
extender probes; in this embodiment a hybridization complex is formed between a portion of the target
sequence and a first portton of a capture extender probe, and an additional hybridization complex
between a second portion of tiie capture extender probe and a portion of the capture probe. Additional
preferred embodiments utilize additional capture probes, thus forming a hybridization complex
between a portion of tiie target sequence and a first portion of a second capture extends probe, and
an additional hybridization complex between a second portion of the second capture extender probe
and a second portion of ttie capture probe. Nbfi-nucleic acid embodiments utilize capture binding
ligands and optional capture extender Hgands.

Allematively, ttie attachment of ttie target sequence to the electrode is done simultaneously with ttie
otiier reactions.

The method proceeds with ttie introduction of ampfifier probes, if utilized. In a preferred embodiment,
the amplifier probe comprises a first probe sequence that is substantially complementary to a portion •
of the target sequence, and at least one amplification sequence.

wo 99/57317 PCr/US99/10104
In one embodiment, the first probe sequence of the amplifier probe is hybridized to the target
sequence, and any unhybridized amplifier probe fereinoved. This will generally be done as is known
In the art, and depends on the type of assay. When the target sequence is imnrobilized on a surface .
such as an electrode, the removal of excess reagents generally is done via one or more washing
steps, as will be appreciated by those in the art. In this embodiment, the target may be immobilized on
any solid support. When the target sequence is not immobilized on a surface, the removal of excess
reagents such as the probes of the invention may be done by adding beads (i.e. solid support
particles) that contain complementary sequences to the probes, such that the excess probes bind to
the beads. The beads can then be removed, for example by centrifugation. filtration, the application of
magnetic or electrostatic fields, etc. .

The reaction mbdure is then subjected to conditions (temperature, high saR, changes In pH. etc.) under
which the amplifier probe disassociates ftom the target sequence, and the ampfifier probe is collected.
The amplifier probe may then be added to an electrode comprising capture probes for the ampfifier
probes, label probes added, and detection Is achieved.

In a preferred embodiment, a larger pool of probe is generated by adding more amplifier probe to the
target sequence and the hybridization/disassociatlon reactions are repeated, to generate a larger pool
of ampBfler probe. This pool of amplifier probe Is then added to an electrode comprising amplifier
capture probes probes added, and detection proceeds.

In thjs embodiment, It is preferred that the target analyte be ImmobHeed on a soHd support, including
an electrode, using the methods described herein; although as will be appreciated by those In the art,
alternate solid support attachment technologies may be used, such as attachment to glass, polymers,
etc. It is possible to do the reaction on one sofid support and then add the pooled amplifier probe to an
eiectrode for detectioa

In a preferred embodiment, the amplifier probe comprises a multiplicity of amplification sequences.

In one embddlmeni the first prc*e sequence of the amplifier probe Is hybrideed to the ta^^^
sequence, and any unhybridized amplifier probe is removed. Again, preferred embodiments utaize
Immoblfeed target sequences, wherein the target sequences are immobilized hybridization with v
eapture probes that are attached to the eiectrode, or hybridization to capture extender probes that in
turn hybridize wifli immobiTized capture probes as is described heieiit. Generally, in these
embodiments, thp capture probes and the detection probes are immoijilized on the electrode,
generally at the same 'address*.

wo 99/57317 PCTAJS99n0104
In a preferred embodiment, the first probe sequence of the amplifier probe is hybridized to a first
portion of at least one label extender probe, and a second portion of the label extender probe is
hybridized to a portion of the target sequence. Other preferred embodiments utilize more than one
label extender probe, as is generally shown in Figure 60.

In a preferred embodiment, the amplification sequences of the amplifier probe are used directly for
detection, by hybridizing at least one label probe sequence.

The invention thus provides assay complexes that minimally comprise a target sequence and a label
probe. 'Assay complex" herein is meant the collection of binding complexes comprising capture
binding ligands. target analytes (or analogs, as described below) and label moieties comprising
recruitment linkers that allows detection. The composition of the assay complex depends on the use
of the different components outlined herein. Thus, in Figure 6A, the assay complex comprises the
capture probe and the target sequence. The assay complexes may also include capture extender
ngands (including probes), label extender ligands, and amplifier ligands, as outlined herein, depending
on the configuration used.

The assays are generally run under conditions which allows formation of the assay cornplex only In the
presence of target Stringency can be controlled by altering a step parameter that is a themnodynamic
variable, including, but not limited to. temperature, fbnnamlde concentration, salt concentration,
chaotropic salt concentratfon pH, organic solvent concentration, etc.

These parameters may also be used to control non-specific binding for nucleic acids, as Is generally
outlined in U.S. Patent No. 5,681.697. Thus It may be desirable to perform certain steps at higher
stringency conditions; for example, when an initial hybridization step is done between the target
sequence and the label extender and capture extender probes. Running this step at conditions which
fiavor spectfk: binding can aUow the reduction of non-specffi

In a prefenBd embodiment, when all of the components outlined herein are used, a preferred nrtethod
for nucleic acid detection Is as follows. Single-stranded target sequence is incubated under
hybridization conditions with the capture extender probes and the label extender probes. A prefen-ed
embodiment does this reaction in the presence of the electrode with immobilized capture probes,
although this may also be done in two steps, with the initial incubation and the subsequent addition to
the electrode. Excess reagente are washed off, and amplifier probes are then added. If preamplifier
probes are used, they n)ay be added either prior to the ampfifier probes orslm^^^
amplifier probes. Excess reagents are washed off, and labef probes are then add^. Excess reagents
are washed off, and detection proceeds as outlined below.

wo 99/57317 PCTA)S99/10I04

In one ernbodiment, a number of capture probes (or capture probes and.capture extender probes) that,
are each substantially complennentary to a different portion of the target sequence are used.

Again» as outlined herein, when amplifier probes are used, the system is generally configured such
that upon label probe binding, the recruitment linkers comprising the ETMs are placed in proximity to •
the monolayer surface. Thus for example, when the ETMs are attached via "dendrimer" type
structures as outlined herein, the length of the linkers from the nucleic acid point of attachment to the
ETMs may vary, particularly with the length of the capture probe when capture extender probes are
used. That fs, longer capture probes, with capture extenders, can result tn the target sequences being
"held" further away from the surface than for shorter capture probes. Adding extra linking sequences
between the probe nucleic acW and the ETMs can result in the ETMs being spatially closer to the
surface, ghring better resuite.

In addition, if desirable, nuclefc acids utilized in ttie invention may also be llgated together pnor to
detection, if applicable, by using standard molecular biology techniques such as the use of a ligase.
Similarly, if desirable for stability, cross-linking agents may be added to hold the structures stable.

Otiier embodiments of the invention utilize different steps. For example, competitive assays may be
run. In this embodiment, the target analyte in a sample way be replaced by a target analyte analog
comprising a portion that either comprises a recruitment linker or can indirectiy bind a recruitment
linker. This may be done as Is known in the art fbr example by using affinity chromatography
techniques that exchange the anak)g for the analyte, leaving the analyte bound and ttie analog free to .
interact witti ttie capture binding ligands on ttie electrode surface. This is generally deputed in Figure
4A.

Alternatively, a prefen^d embodiment utilizes a competitive binding assay when the solution binding
ligand comprises a directly or indirectiy associated recruitment linker comprising ETMs; In thfe
embodiment, a target analyte or target analyte analog ttiat will bind ttie solution binding ligand is
attached to ttie surfece. The solution binding ligand will bind to ttie surfece bound analyte and give a
signal Upon introduction of ttie target analyte of ttie sample, a proportion of ttie solution binding
ligand win dissodate fifom ttie surface bound target and bind to ttie inconting target analyte. Thus, a
toss of s^nal proportional to. the anrK>unt of target analyte In ttie san^

The composHtons of ttie invention are general^ syntiiesized as outiined below, gene^lly utiTKlrig
techniques weO knovwi in ttie art As wDI be appreciated by ttiose In ttie art, many of ttie techniques
outtlned below are directed to nuclefe adds containing a ribose-phosphate backbone. However, as
outtined above, many aitemate nucleic add analogs may be uttlized. some of whfch may not contain

wo 99/57317 PCTA;S99/10104

eitiier ribose or phosphate in the backbone. In these embodimenls, for attachment at positions other
than the base, attachment is done as will be appreciated by those In the art, depending on the
backbone. Thus; for example, attachment can be made at the carbon atonrw of the PNA backborie, as
is described below, or at either terminus of the PNA.

The compositions may be nrtade In several ways. A preferred method first synthesizes a conducive
oligomer attached to a nucleoside, with addition of additional nucleosides to form the capture probe
followed by attachment to the electrode. Alternatively, the whole capture probe may be made and
then the completed conductive oligomer added, followed by attachment to the electrode. Alternatively,
a monolayer of conductive oligomer (some of which have functional groups for attachment of capture
probes) Is attached to the electrode first, followed by attachment of the capture probe. The latter two
methods may be preferred when conductive oligomers are used which are not stable in the solvents
and under the conditions used in traditk>nal nucleic acid synthesis.

In a preferred embodiment, the compositions of the invention are made by first forming the conductive
oligomer covalently attached to the nucleoside, foltowed by the addition of additional nucleosides to
form a capture probe nucleic add, vWth the last step, comprising the addition of the conductive oligomer
to the electrode.

The attachment of the conductive oligomer to the nucleoside may be done in several ways. In a
prefen^ embodiment all or part of the conductive oligomer is synthesized first (generally with a
functional group on the end for attachment to the electrode), which is then attached to the nucleoside.
Additional nucleosides are then added as required, with the last step generally being attachment to the
electrode. Alternatively, oligomer units are added one at a time to the nucleoside, with addition of
additional nucleoskies and attachment to the electrode. A number of representative syntheses are
shown in the Rgures of WO 98/20162, PCT US98/12430, PCT US99/01705 and PCT US99/01703, all
of which are express^ incorporated by reference.

The conductive oligomer Is then attached to a nucleoside that may contain one (or more) of the
ol^iomer units, attached as depicted herein.

In a preferred embodiment, attachment is to a ribose of the ribose-phosphate backbone in a number of
ways, including attachment via amkle and amine finkages. In a preferred embodiment, there is at least
a methylene group or other short aBphatfc alkyi groups (as a Z group) between the nitrogen attached
to the ribose and the aromatic ring of ttie conductive oFigomer.

Alternatively, attachment Is via a phosphate of ttie ribose-phosphate backbone.

wo 99757317 PCTAJS99/10104
In a preferred embodiment, attachment is via the base, and can Include acetylene linkages and amide
linkages. In a prefen«l emtxxlimenti protecting groups may be added to the base prior to addition of
the conductira oligomers. In addition, the palladium cross-coupling reactions may be altered to
prevent dimerization problems; l.e. two conductrve oligomers (fimerizlng. rather than coupling to the
t>ase.

Aitematively. attachment to the base may be done by making the nudeoslde with one unit of the
oligomer, followed by the addition of others.

Once the modified nucieoskJes are prepared, protected and activated, prior to attachment to the
electrode, they may be incorporated into a growing ollgonucleotWe by standard synthetic techniques
(GaJt, bligpnucleotkie Synthesis: A Practfcal Approach. |RL Press. Oxford. UK 1984; Eckstein) in
severalways.

In one embodiment, one or more modified nucleosMes ar6 convisrted to the triphosphate Ibrm and
incorporated into a growing oligonucleotide chain by using standard nrwlecular biokjgy techniques such
as with the use of the enzyme DNA polymerase I, T4 DMA polyriteiase. T7 DMA polymerase. Taq
DNA polymerase, reverse transcriptase, and RNA polymerases. For the incorporafiorvof a 3' modified
nucleoside to a nuclefc ackJ. tenninal deoxynucleotidyltransferase may be used. (RaUiff, Temiinal
deoxynucteotidyitransferase. In The Enzymes. Vol 14A P.D. Boyer ed. pp 105-il8. Academic Press.
San Diego, CA 1981). Thus^ the present invention provides debxynbonudeoside triphosphates
comprising a covalently attached ETM. Preferred embodiments utilize ETM attachment to the base or
the backbone, such as the ribose (preferably in the 2' posltton). as is generally depicted betow in
Structures 42 and 43:

Structure 42

wo 99/57317

. II

-O P-

Thus, in some embodiments, it may be possible to generate the nucleic adds comprising ETMs in situ.
For example, a target sequence can hybridize to a capture probe (for example on the surface) in such
a way that the terminus of the target sequence is exposed, i.e. unhybridized. The addition of enzyme
and triphosphate nucleotides labelled with ETMs allows the in situ creation of the label. Similarly,
using labeled nucleotides recognized by polymerases can allow simultaneous PCR and detection; that
is, the target sequences are generated in situ.

In a preferred embodiment the nrodifled nucleoside is converted to the phosphoramidite or H-
phosphonate form, which are then used In solid-phase or solution syntheses of oligonucleotides. In
this way the modified nucleoside, either for attachment at the ribose (l.e. amino- or thioi-modified
nucleosides) or the base, is incorporated into the oligonucleotide at either art internal position or the 5'
terminus. This is generally done in one of two ways. First, the 5' positfon of the ribose is protected
with 4\4-dimethoxytrityl (DMT) followed by reaction with either 2-cyanoethoxy-bis-
diisopropylaminophosphine in the presence of diisppropylamnoonium tetrazojide, or by reaction with
chlorodiisopropylamino 2'-cyanoethyoxyphosphine, to give the phosphoramidite as is known in the art;
although other techniques may be used as will be appreciated by those in the art See Gait supra;
Caruthers, Science 230:281 (1985), both of which are expressly incorporated herein by reference.

For attachment of a group to the 3' tenninus, a preferred method utilizes the'atlachment of the
modified nucleoside (or the nucleoside replacement) to controlled pore glass (CPG) or other
oligomeric supports. In this embodiment the nrKxJified nucleoside is protected at the 5' end with DMT,
and then reacted with sucdnfc anhydride with activation. The i^esulting succinyl compound is attached
to CPG or other oligon^ric supports as is known in the art Further phosphoramidite nucleosides are
added, either modified or not to the 5' end after deprotection, Thus, the present invention provWes
conductive oligomers or insulators covalentfy attached to nucleosides attached to solid origomeric
supports such as CPG. and phosphoramidite derivatives of the nucleosides of the inventfon.

The inventfon further provMes nrtethods of making label probes with recruitment finkers comprising
ETMs. These synthetfcreaclfonsvwil depend on tte character of the recruitment R^^^

wo 99/57317 PCT/US99/10104
method of attachment of the ETM, as will be appreciated by those ia the art For nucleic acid
recaiitment linkers, the label probes are generally made as outlined herein with the incorporation of
ETMs at one or more positions. When a transition metal complex is used as the ETM. synthesis may
occur in several ways. In a prefened embodiment, the ligand(s) are added to a nucleoside, followed
by the transition metal ion, and then the nucleoside with the transition metal complex attached is
added to an oligonucleotide, i.e. by addition to the nucleic acid synthesizer. Alternatively, the
llgand(s) may be attached, followed by incorportation into a growing oligonucleotide chain, followed by
the addition of the metal ion.

In a preferred embodiment, ETMs are attached to a ribose of the ribose-phosphate backbone. This is
generally done as is outlined herein for conductive ollgon^ers. as described herein, and in PCX
publication WO 95/15971, using amino-modified or oxo-nwdified nucleosides, at either the Z or 3*
position of the ribose. The amino group may then be used either as a ligand, for example as a
transition metal ligand for attachment of the metal ion, or as a chemically functional group that can be
used for attachment of other ligands or organic ETMs, for example via amide linkages, as will be
appreciated by those in the art For example, the examples describe the synthesis of nucleosides with
a variety of ETMs attached via the nbose.

In a preferred embodin:ient, ETMs are attached to a phosphate of the ribose-phosphate backbone. As
outlined herein, this may be done using phosphodiester analogs such as phosphoramWite bonds, see
generally PCT pubifcation WO 95/15971, or the figures.

Attachment to alternate backbones, for example peptide nuclefc adds or alternate phosphate linkage
will be done as will be appreciated by those In the art

In a prefen-ed embodiment. ETMs are attached to a base of the nucleoside. This may be done in a
variety of ways. In one embodiment, amino groups of the base, either naturally dccumng or added as
is described herein (see the fiigures, for example), are used either as ligands for transition metal
complexes or ^ a chemically functional group that can be used to add other figands, for example via
an annide linkage, or organic ETMs. This Is done as wfll be apprecfeted by those in the art
Altematively, nucleosides containing halogen atoms atteched to the heterocyclic ring are commercially
avanable. Acetylene linked ligands ntay be added using the hatogenated bases, as is generally
known; see for example, TzaHs etal., Tetrahedron Lett 36(34):601 7-6020 (1996); Tzalfe et al..
Tetrahedron Lett 36(2):3489^90 (1995); arid Jzafe et al., Chem. Communfeatk)ns (In press) 1996,
all ofwhich are hereby expressly Incorporated by reference. See also the figures and the examples, .
which describes the synthesis of meteltocenes (in this case, fenrocene) attached via acetylene
linkages to the bases.

wo 99/57317 PCT/US99/10104

In one embodiment, the nudeosides are nrade with transition metaf ligands, incorporated into a nucleic
acid, and then the transition metal ion and any remaining necessary ligands are added as is ioiown in
the art In an alternative embodiment, the transition metal ion and addi^onal ligands are added prior to
incorporation into the nucleic acid.

OnoB the nucleic adds of the Invention are made, with a covalently attached attachment linker (i.e,
either an Insulator or a conductive oligomer), the attachment linker Is attached to the electrode. The
method will vary depending on the type of electrode used. As is described herein, the attachment
linkers are generally made with a terminal "A" linker to facilitate attachment to the electrode. For the
purposes of this application, a sulfur-gold attachment is considered a covalent attachment.

In a preferred embodiment, conductive oligomers, insulators, and atlachnr)ent linkers are covalently
attached via sulfur linkages to the electrode. However, surprisingly, traditional protecting groups for
use of attaching molecules to gold electrodes are generally not Ideal for use in both synthesis of the
composittons described herein and inclusion in oligonucleotide synthetic reactions. According^, the
present invention provides novel methods for the attachment of conductive oligomers to gold
electrodes, utilizing unusual protecting groups, including ethylpyridine, and trimethylsilylethyl as is
depicted in the Figures. However, as will be appreciated by those In the art, when the conductive
oligomers do not contain nucleic ackJs, traditional protecting groups such as acetyl groups and others
nroybeused. See Greene et al., supra.

This may be done In several ways. In a pr^fen^ed embodiment, the subun'rt of the conductive oligomer
Which contains the sulfur atom for attachment to the electrode is protected with an ethyl-pyridine or
trimethylsilylethyl group. For the fonner, this is generally done by contacting the subunit containing the
sulfur atom (preferably In the form of a sulfhydryl) with a vinyl pyridine group or vinyl trimethylsilylethyl
group under condittons whereby an ethylpyridine group or trimethytellylethyl group Is added to the
sulfuratom.

This subunit also generally contains a functfonal moiety for attachment of additional subunlts, and thus
additional subunits are attached to form ttie conductive oligomer. The conductive oligomer is then
attached to a nucleoside, and additional nucleosides attached. The protecting group is ttien removed
and tile sulfur-gold covalent attachment is made. Alternatively, all or part of the conductive ofigomer is
male, and ttien eittier a subunit containing a protected sulfur atom fe added, or a sulfur atom is added
and ttien protected. The conductive oligomer is ttien attached to a nucleoside, and additional
nucleosides attached. Alternatively, ttie conductive oligomer attached to a nucleic add is made, and
then either a subunit containing a protected sulfur atom is added, or a sulfur atom is added and ttien
protected. Alternatively, ttie ethyl pyridine protecting group may be used as above, but removed after

wo 99/57317

PCT/US99/10104

one or more steps and reptacecf with a standard protecting group tike a disulfide. Thus/the ethyl
pyridine or trinriethylsily lethy I group rnay serve as the protecting group fo^
reacttons, and then renioved and replaced with a traditional prot^

5 By "subtinif of a conductive polymer herein is meant at least the moiety of the conductive oligomer to
which the sulfur atom is attached, although additional atoms may be present, including either
functional groups which albw the addition of additional components of the conductive oligomer, or
additional components of the conductive oligomer. Thus, for example, when Structure 1 oligomers are
used, a subunit comprises at least the first Y group.

A prefenred method comprises 1) adding an ethyl pyridine or trimethylsilylethy I protecting group to a
sulfur atom attached to a first subunit of a conductive oligomer, generally done by adding a vinyl
pyridine or trimethylsilylethy! group to a sulfhydryl; 2) adding additional subunits to fomi the conductive
oligomer, 3) adding at least a first nucleoside to the conductive oligomer; 4) adding additional
15 nucleosides to the first nucleoside to form a nucleic acid; 5) attaching the conductive oligomer to the
gold electrode. This may also be done in the absence of nucleosides.

The above methods may also be used to attach insulator molecules to a gold electrode, and moieties
comprising capture binding ligands.

in a prefenred embodiment a monolayer comprising conductive oligomers (and preferably insulators)
is added to the electrode. Generally, the chemistry of addition is similar to or the same as the addition
of conducbve oligomers to the electrode, i.e. using a sulfur atom for attachment to a gold electrode,
etc. Compositions comprising nnonolayers in addition to the conductive oligomers covalently attached

25 to nucleic acids niay be made in at least one of five ways: (1) addition of the monolayer, followed by
subsequent addition of the atl^chnnent linlcerHfiucleic acid complex; (2) addition of theattachment
linker-nucleic add complex followed by addition of the monolayer; (3) simultaneous addition of the
monolayer and attachment linker-nucleic acid complex; (4) formation of a monolayer (using any of 1 , 2
or 3) whfch includes attachment linkers which terminate in a functional moiety suitable for attachment

30 of a completed nudete acW; or (5) fonnation of a monolayer which indudes attachment linkers which
tenninate in a functional moiety suitable for nudek: add synthesis. Le. the nucleic add is synthesized
on the surface of the monolayer as is known in the art Such suitable functional moieties indude, but
are not limtted to, riucleo^des. amino groups, carboxyl groups, protected sulfur moieties, or hydroxyl
groups for phosph(^mkiite addittons. The examples describe the fbnnatlbn of a monolayer on a gold

35' electrode using the preferred method (1).

wo 99/57317 PCT/US99A10104

In a preferred embodiment, the nucleic acid is a peptide liucleic acid or analog. In this emtxxiiment,
the invention provides peptide nucleic adds with at least one covalently attached ETM or attachment
linker. In a preferred embodiment, these moieties are covalently attached to an monomeric subunit of
the PNA. By "monomeric subunit of PNA" herein Is meant the -NH-CHjCHa-NCCOCHrBaseHJHj-CO-
5 monomer, or derivatives (herein included within the definition of "nucleoside") of PNA. For example,
the number of cari?on atoms in the PNA backbone may be altered; see generally Nielsen et al., Chem.
Soc. Rev: 1997 page 73, which discloses a number of PNA derivatives, herein expressly incorporated
by reference. Similarly, the amide bond linking the base to the backbone may be altered; . .

phosphoramide and sulfuramkie bonds may be used. Altematively, the moieties are attached to an

10 internal monomeric subunit By "internal" herein is meant that the monomeric subunit is not either the
N-terminal monomeric subunit or the C-temninal monomeric subunit In this embodiment, the moieties
can be attached either to a base or to the backbone of the monomeric subunit Attachment to the
base is done as outlined herein or known In the literature. In general, the moieties are added to a
base whrch is then incorporated into a PNA as outlined herein. The base may be either protected, as

15 required for incorporation into the PNA synthetfc reaction, or derivatized, to allow incorporation, either
prior to the addition of the chemical substituent or aftenvards. Protection and derivatization of the
bases is shown in the Figures. The bases can then be incorporated into nrK)nomeric subunits; the
figures depict two different chemk:al substituente, an ETM and a conductive oligomer, atteched at a
base.

In a preferred embodiment, the moieties are covalently attached to the backbone of the PNA
monomer. The attachment Is generally to one of the unsubstituted cartK)n atoms of the monomeric
subunit. preferably the a-carbon of the backbone, as is depicted in the Figures, although attachment at
either of the carbon 1 or 2 posittons, or the a-cariton of the amide bond linking the base to the

2 5 backbone may t>e done. In the case of PNA anak)gs. other carbons or atoms may be substituted as

well. In a preferred embbdiment moieties are added at the a-carbon atoms, either to a tenminal
moriomeric subunit or an intemal one/

In this embodiment, a modified nrx^nomeric subunit is synthesized with an ETM or an attachnfient

3 0 linker, or a functional group for its attachment, and then the base is added and the nrKxJrfied monomer

can be incorporated Into a growing PNA chain. The figures depict the s

oligomer covalently attached to the backbone of a PNA nrwnomeric subunit, and the synthesis of a

fenwene attached to the backbone of a monomeric subunit

35 Once generated, the morrameric subunits with covalently attached nrniette^ are incorporated into a . .
PNA using the techniques outfined in Will ^ al.. Tetrahedron 51(44):12069-12082 (1995). and
Vanderlaan et al.. Tett Let 38:2249-2252 (1997), twth of which are hereby expressly incorporated in

wo 99/57317 PCtAJS99/10ia4

their entirety. These procedures allow the.additton of chernlcal substituents to peptide nucleic acids
without destroying the chemical substituents.

As will be appreciated by those in the art, electrodes may be made that have any combination of
nucleic acids, conductive oligomers and insulators.

The compositions of the invention may additionally contain one or more labels at any position. By
"laber herein is meant an element (e.g. an isotope) or chemical compound that is attached to enable
the detection of the compound. Preferred labels are radioactive isotopic labels, and colored or
fluorescent dyes. The labels may be incorporated into the compound at any position. In addition, the
compositions of the invention may also contain other moieties such as cross-linking agents to facilitate
cross-finking of the target-probe complex. See for example, Lukhtanov et al., Nucl. AcWs. Res.
24(4):683 (1996) and Tabone ef aL, Bkx*em. 33:375 (1994). both of which are expressly incorporated
by reference.

Once made, the compositions find use in a number of applications, as described herein. In partfcular,
the compositions of the Invention find use in target analyte assays. As will be appreciated by those in
the art, electrodes can be made that have a single species of binding ligandssuch as nucleic acid, Le.
a single binding ligand, or multiple binding llgand species.

in additfon, as.outlined herein, the use of a solid support such as an electrode enables the use of
these probes in an array form. The use of oligonucleotide anrays are well known in the art and the
methods and composittons herein allow the use of an^y formats for other target analytes as welL In
addition, techniques are known for "addressing* locattons within an electrode and for the surface
nxxlificatfon of electrodes. Thus, In a preferred embodiment arrays of different binding llgands are
laki down on the electrode, each of whfch are covatently attactied to the electrode via a conductive
linker. In this embodiment the number of different species may vary widely, from one to thousands,
with from about 4 to about 100,000 being prefenred, and from about 10 to about 10.000 being
particularly preferred.

The Invention finds use In the screening of candidate bioactive agents for therapeutic agents that can
alter fte binding of ttie analyte to thd binding ligand, and thus may be involved in biotogical functfori.
The \em "agenr or "exogeneous compound* as used herein describes any molecule, e.g., protein.
oBgopepllde, smaB organfc molecule, poVsaccharide. polynudeol^^

directly or indirectly altering target analyte binding. Generally a plurality of assay mixtures are run in .
parallel with different agent concentratfons to obtain a differential response to the various

wo 99/57317 PCT/US99/10104

concentratibns. Typically, one of these concentrations serves as a negative control, i.e., at zero
concentratioh or l)etow the level of detection. ^

Candidate agents encompass numerous chemical classes, though typically they are organic . .
5 niolecules, preferably small organic compounds having a molecular weight of more than 100 and less
than atx>Ut 2,500 daltons. Candidate agents comprise functional groups necessary for structural
interaction with proteins, particularly hydrogen bonding, and typically include at least an amine,
cart>onyl, hydroxyl or carfooxyl group, preferably at least two of the functional chemical groups. The
candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or
10 polyaromatic structures substituted with one or more of the above functional groups. Candidate
agents are also found among biomolecules including peptides, saccharides, fatty adds/ steroids,
purines, pyrimidines, derivatives, structural analogs or combinations thereof. Particularly preferred are
peptides.

15 Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural
compounds. For example, numerous means are available for random and directed synthesis of a
wide variety of organic compounds and biomolecules, including expression of randomized
oligonucleotides. Altematively* libraries of natural compounds in the fonm of bacterial, fungal, plant
and animal extracts are available or readily produced. Additionally, natural or synthetically produced

20 libraries and compounds are readily modified through conventional chemical, physical and biochemical
means. Known pharmacological agents may be subjected to directed or random chemical
modifications, such as acylation, alkylatton. esterification, amidification to produce structural analogs.

Candidate agents may be added either before or after ttie target analyte.
25 ' • ' • .

Once the assay complexes of the invention are made, that minimally comprise a target sequence and
a label probei detection proceeds with electronic initiation: Without being limited by the mechanism or
thecxy, detection is based on the transfer of electrons from the ETM to the electrode.

3 0 Detection of electron transfer, i.e. the presence of the ETMs, is generally initiated electronically, with
voltage being prefenred. A potential is applied to the assay complex. Precise control and variations in
the applied potential can be via a potentiostat and eHher a three electrode system (one reference, one
sample (or woricing) and one counter electrode) or a two electrode system (one sample and one
counter el^^trode). Ths allows matching of applied potential to peak potential of the system which

35 depends in part on the choice of ETMs and in part on the conductive oligomer used, the composition .
and integrify of the monolayer, and what type of reference electrode Is used. As diescribed herein,
ferrocene is a preferred ETM.

WQ 99/57317 PCT/US99/10104

In a prefen-ed embodiment a co-reductant or eo-oxidant (collectively, co-redoxant) is used, as an
additional electaron source or sink. See generally Sato et al., Bull Chem. Soc. Jpn 66:1032 (1993);
Uosaki et al.. Electrochimica Acta 36:1799 (1991); and Alleman etal.. J. Phys. Chem 100:17050
(1996); all of which are incorporated by reference.

In a preferred embodiment, an Input electron source in solution is used in the initiation of electron
transfer, preferably when initiation and detection are being done using DO current or at AC
frequencies where diffusion is not limiting. In general, as will be appreciated by those in the art, .
preferred embodiments utilize monolayers that contain a minimum of "holes", such that short-circuiting
of the system is avcrided. This hiay be done in several general ways. In a preferred embodiment, an
input electron source is used that has a lower or similar redox potential than the ETM of the label
probe. Thus, at voltages above the redox potential of the input electron source, both the ETM and ttie
input electron source are oxkiized and can ttius donate electrons; the ETM donates an electron to the
electrode and the input source donates to tiie ETM. For example, fenrocene, as a ETM attached to the
compositions of the invention as described in ttie examples, has a redox potential of roughly 200 mV in
aqueous solution (which can change sjgniffeantly depending on what tiie ferrocene is bound to, the
manner of the linkage and the presence of any substitution groups). Ferrocyanide, an electiDn
source, has a redox potential of roughly 200 mV as well (in aqueous solution). Acxordingly, at or
above voltages of roughly 200 mV, fen-ocene is converted to femcenlum, which then t^nsfers an
electron to the electrode. Now tiie ferricyanide can be oxidized to transfer an electron to the ETM. In
this way. the electron source (or co-reductant) serves to amplify the signal generated in the system, as
the electrori source molecules rapklly and repeatedly donate electrons to ttie ETM attached to tt)e
nucleic acid. The rate of electron donation or acceptance will be limited by ttie rate of diffusion of the
co-reductant, ttie electron transfer between tiie co-reductant and the ETM. whk^h in turin is affected by
the concentration and size, etc.

Alternatively, input electrori sources tiiat have lower redox potentials tfian tiie ETM are used. At
voltages less tiian tiie redox potential of ttie ETM, but higher ttian ttie redox potential of tiie electron
source, ttie input source such as fenx>cyanlde is unable to be oxkled and ttius is unable to donate an .
election to ttie ETM; i.e. no electron transfer occurs. Once femjcene is oxidized, ttieh there is a
pattiway for electron transfer.

In an alternate prefisrred embodiment, an input ele^n source is used ttiat has a higher redox
potential ttian the ETM of ttie label probe. For example, luminol, an electron source, has a redox
potential of roughly 720 mV. At voltages higher ttian ttie redox potential of ttie ETM, but IdWer ttian ttie
redox potential of ttie electron source, i.e. 200 - 720 mV, ttie fem)cene is oxkJed, and tiransfers a
single electron to ttie electrode via ttie conductive oligomer. However, ttie ETM is unable to accept

wo 99/57317 PCT/US99/10104

any electrons from the luminol electron source, since the voltages are less than the redox potential of
the luminol. However, at or above the redox potential of luminol, the luminol then transfers an
electron to the ETM, allowing rapid and repeated electron transfer. In this way, the electron source (or
c6-reductant) serves to ampfify the signal generated in the system, as the elec^n source molecules
5 rapidly andrepeatedly donate electrons to the ETM of the label probe.

Luminol has the added benefit of becoming a cheriiiluminiscent species upon oxidation (see Jirica et
al, Analytica Chimica Acta 284:345 (1993)). thus allowing photo-detection of electron transfer from the
ETM to the electrode. Thus, as long as the luminol Is unable to contact the electrode directly, i.e. in

10 the presence of the SAM such that there is no efficient electron transfer pathway to the electrode,

luminol can only be oxidized by transfening an electron to the ETM on the label probe! When the ETM
is not present i.e/when the target sequence is not hybridized to the composition of the invention,
luminol is not significantly oxidized, resulting in a low photon emission and thus a low (if any) signal
from the luminol. In the presence of the target, a much larger signal is generated. Thus, the measure

15 of luminol oxidation by photon emission Is an indirect measurement of the ability of the ETM to donate
electrons to the electrode. Furthermore, since photon detection is generally more sensitive than
electronic detection, the sensitivity of the system may be increased. Initial results suggest that
luminescence may depend on hydrogen peroxide concentration, pH. and luminol concentration, Uie
latter of which appears to be non-linear.

20 .

Suitable electron source molecules are well known in the art and include, but are hot limited to,
ferricyanide, and luminol.

Altematively. output electron acceptors or sinks could be used, i.e. the above reactions could be run in

2 5 reverse, witii the ETM such as a metallocene recemng an electron from the electrode, converting it to

ti)e metallicenium, with the output electron acceptor ttien accepting the electron rapidly and
^ repeatedly. In tills embodiment cobalticenium is ttie preferred ETM.

The presence of the ETMs at the surface of the monolayer can be detected in a vartety of ways. A

3 0 variety of detection mettiods may be iised. Including, but not limited to, optical detection (as a r^utt of

spectral changes upon changes In redox states), which includes fluofescence, phosphorescence,^
luminlscence. chemiluminescence, electrochemiluminescence, and refractive index; and electn^iic '
detection, including, but not limited to, amperomnr)etry, voltammetry, capacitance and impedence.
These mettiods Include time or frequency dependent methods based on AC or DC currents, pulsed
35 methods, kxk-in techniques, filtering (high pass, low pass, band pass), and time-resolved technkjues
including time*resolved fluorescence.

wo 99/57317 PCT/US99/10104
In one embodiment, the efficierrt transfer of elec*^

stereotyped changes in the redox state of the ETIVI. VVith many ETMs including the complexes of
ruthenium containing bipyridine. pyridine and imidazole rings, these changes in redox slate are
associated with changes in spectral properties. Significant differences in absorbance are observed
between reduced and oxidized states for these molecules. See for example Fabbriz2ret al.,Chem.
Soc. Rev. 1995 ppl 97-202). These differences can be monitored using a spectrophotometer or
simple photomultipiier tube device.

In thfe embodiment, possible electron donors and acceptors include all the derivatives listed above for
photoadivatton or Initiation. Prefened electron donors and acceptors have characteristically large
spectral changes upon oxidation and reduction resulting in highly sensitive monitoring of electron
transfer. Such examples include Ru{NH,)^ and Ru{bpy)2im as prefened examples, it should be
understood that only the donor or acceptor that is being monitored by absorbance need have ideal
spectral characteristics.

In a preferred embodiment, the electron transfer is detected fluorometrically. Numerous transition
metal complexes, including those of ruthenium, have distinct fluorescence properties. Therefore, the
change in redox state of the electron donore and electron acceptors attached to the nucleic acid can
be monitored very sensitively using fluorescence, for exampte with Ru(4.7-biphenyl2-phenanthroline),^
. The production of tills compound can be easily measured using standard fluorescence assay
techniques. For example, laser induced fluorescence can be recorded in a standard single cell
fluorimeter. a flow through "online" fluorimeter (such as Vtose attached to a chromatography system)
or a muHi-sanfiple •pfeteweader' similar to ttKw marlteted for 96^yen iminuno asM

Alternatively, fluorescence can be measured using fiber optic sensors with nudeic acid probes in
solution or attached to the fiber optic. Ruorescence is monitored using a photomultipiier tube or other

light detection instrument attached to ttie fiber optid The advantage of this system is the ex^
small volumes of sample tiiat can be assayed.

In addition, scanning fluorescence detedore sudi as ttie Ruorlmager sold by Molecular Dynamics are
Ideally suited to monitoring Oie fluorescence of modified nudeic add motecules arrayed on sofid
surfaces. The advantage of tills sirslem is tii© large number of eledron transfer probes ttiat
scanned at once using chips covered Witt! ttwusands of distind nudeic add probes.

fctenytransitionmetalcomplexesdlsplayfluorescencewlthlargeStokes^^ Suitable examptes
indude bis- and trisphenanttiroline complexes and bis- and trisbipyridyl comptexes of transition metals
sudi as nrthenium (see Juris. A.. Balzani. V.. et al. Coord. Chem. Rev.. V. 84. p. 85-277. 1988).

W099/57317 PCTAJS99/10104
Preferred examples display efficient fluorescence (reasonably high quantum yields) as well as low
reorganization energies. These Include Ru(4,7-biphenyl2-phenanthroline)3^*, Ru(4.4'-diphenyl-2,2'-
bipyridine)3^^ and platinum complexes (see Cummings et al, J. Am. Chem. Soc. 118:1949-1960
(1996), incorporated by reference). Alternatively, a reduction in fluorescence associated with
5 hybridization can be measured using these systems.

In a further embodiment, electrochemiluminescence Is used as the basis of the electron transfier
detection. With some ETMs such as Ru^*(bpy)3, direct luminescence accompanies excited state
decay. Changes in this property are associated with nucleic acid hybridization and can be monitored
10 with a simple photomultiplier tube an-angement (see Blackburn, G. F, din, Chem, 37: 1534-1539
(1991); and Juris etal., supra.

In a preferred embodiment, electronic detection is used, including amperommetry, voltammetry,
capacitance, and impedence. Suitable techniques include, but are not limited to, electrdgravimetry;

IS coulometry (including controlled potent^l coulometry and constant cun-ent coutortietry); vottameby
(cyclic vottametry, pulse voltametry (nomnal pulse voltametry, square wave voltametry. diffisrentiat
pulse voltametry. Osteryoung square wave voltametry, and cbutostatic pulse techniques); stripping
analysis (aniodic stripping analysis, cathiodic stripping analysis, square wave stripping voltammetry);
conductance measurements (electrolytic conductance, direct analysis); time-dependent

20 electrochemical analyses (chronoamperometry, chronopotentiometry, cyclic chronopotentiometry and
amperometry, AC pplography, chronogalvametry, and chronocoulometry); AC impedance
measurement; capacitance measurement; AC voltametry; and photoelectrochemistry.

In a preferred embodiment nrK>nitoring electron transfer is via amperometric detection. This method of

2 5 detection involves applying a potential (as compared to a sefparate reference electrode) between the

nucleic acid-conjugated electrode and a reference (counter) electrode in the sample containing target
genes of Interest Bectron transfer of differing effidendes is induced in samptes in the presence or
absence of target nudeic add; that is. the presence or absence of the target nudeic acid, and thus the
label probe, can result in different currents.

30 '

The device for measuring electron transfer amperometrically involves sensitive cument detedion and
includes a nreans of controliing the voltage potential, usually a potentiostaL This voltage is optimized
with reference to the potential of the electron donating compfex on the label probe. Possible electron
donating complexes include those previously mentioned with complexes of iron, osmium, platinumi

3 5 cobalt, rhenium and ruthenium being preferred and complexes of iron being moist preferred.

wo 99/57317 PCTAJS99/10104
In a preferred embodiment, alternative electron detection modes.are utiTized. For exarr^Ie,
potentiometric (or voltammetric) measurements involve non^radajc (no net current flow) processes
and are utilized traditionally in pH and other ion detectors. Similar sensors are used to monitor • ,
electron transfer Ijetween the ETIVI and the electrode. In addition, other properties of Insulators (such
5 as resistance) and of conductors (such as conductivity, impedance and capicitance) could be used to
monitor elecfron transfer between ETM and the electrode. Finally, any system that generates a
current (such as electron transfer) also generates a small magnetic field, which may be monitored in
some embodiments.

10 Itshouldbeunderstoodthatonebenefitofthefestratesofelectrontiansferobservedinthe

compositions of the invention is that time resoiufion can greatly enhance the signaMo^oise results of
monitors based on absorbance, fluorescence and electronic current The last rates of electron
transfer of the present invention result both in high signals and stereotyped delays between etectron
transfer initiation and completion. By ampliiying signals of particular delays, such as through the use

15 of pulsed initiation of electron transfer and "lock-in" amplifiers of detection, and Fourier transfomw.

In a preferred embodiment, electron transfer is initiated using altemating current (AC) methods.
Without being bound by theory, it appears that ETMs. bound to an electrode, generally respond
similarly to an AC voltege across a circuit conteining resistors and capacitors. Basically, any methods
20 whichenabtethedetermina«onofthenatureofthesecomplexes,whlchactasares^

capacitor, can be used as the basis of detection. Surprisingly, traditional electrochemical theory, such
as exemplified in Laviron et al.. J. Eledroanal. Chem. 97:135 (1979) and Uviron et al., J. EtectroanaL

Chem 105:35 (1979), both ofwhich are incorporated by reference, do not accurately model the
systems descn-bed herein, except for very small E« (less than 10 mV) and relatively large numbers of
molecules. That is, the AC current (I) is not accurately described by Laviron's equation. This may be
due in part to the fact that this theory assumes an unlimited source and sink of elections, whfch is not
true in the present systems.

A«»rdingly. aHemate equattons were developed, using the Nemst equation and first principles to
devetop a model whtoh more dosely simulates the resulte. This was derived as follows. The Nemst
equation, Equatkm l bekxv. describes the ratto of oxidized (O) to reduced (R) motecutes (number of
mdecutes = n) at any given voltege and temperaturei sinoe not every molecule geb oxMized at the
san» addation potential.

Equation 1,

E -p *^ iLioy

35 ^"-^"V^lil

78.

WO 99/57317 PCT/US99/10104
Edc is the electrode potential, E© is the formal polenfral of the metal complex, R Is the gas constant. T
Is the temperature in degrees Kelvin, n is the number of electrohs transferred, F rs faraday's constant,
[O] is the concentration of oxidized molecules and [R] is the concentration of reduced molecules.

The Nemst equation can be rearranged as shown In Equations 2 and 3:

Equation 2

p P RT , [O]
^ nF \R]

Eoc is the DC component of the potential.

Equations

10. exp^^"^'^ = M

[R]

(2)

(3)

Equation 3 can be rearranged as fpllowis, using nonmafization of the concentration to equal 1 for
simplicity, as shown in Equations 4. 5 and 6. This requires the subsequent multiplicafion by the total
15 number of molecules.

Equation 4 [O] + [RJ = 1
Equation 5 [OJ = 1 - [R]
Equations [R)=l-[0)

Plugging Equation 5 and 6 into Equation 3. and the fact that nF/RT equals 38.9 V\ lor n=1. gives
Equations 7 and 8. which define [O] and [R], respectively:

Equation?

25 . [01= .v(4)

Equations

PR) = _ \ ^ ,5,

1 +exp'»-'

WO 99/57317 PCT/US99/101«4
Taking Into consideration the generation of an AG faradaic current therotio of IOJ/[RJ at any given
potential must be evaluated. At a particular Eoc with an applied E«. as is generally described herein,
at the apex of the E«. more molecules win t)e in the oxidized slate, since the voltage on the surface is
how (Eoc + Eac): at the bottom, more will be reduced since the voltage is lower. Therefore, the AC
current at a given Eoc will be dictated by both the AC and DC voltages, as weH as the shape of the
Nemstian curve. Specifically, if the number of oxidized molecules at the bottom of the AC cyde is
subtracted from the amount at the top of the AC cycle, the total change in a given AC cycle is
obtained, as is generally described by Equation 9. Dividing by 2 then gives the AC amplitude:

Equation 9

Iac - feleptreng 9t fEnr ■»• F..n • /electrons at . g,^)
2

Equation 10 thus describes the AC current which should result
^5 Equation 10

As depicted in Equation 11. the total AC current win be the number of redox moleoiles C). times
20 faraday's constant (F). times the AC frequency (u). times 0.5 (to take Into account the AC amplitud©),
times the ratios derived above in Equation 7. The AC voltage Is approximated by the average. E«^.

Equation 11

= 0 / ^ exp »

2 V ) - 1 ^

1 + exp " 1 + exp *

Using Equation 11. simulations were generated using increasing overpotentlal (AC voKage). Figure
22A shows one of ttiese simulations, while Rgure 22B depicts a simuiatkxi based on traditional theory.
Rgures 23A and 23B depicts actual experimental data using ttie Fc^re of Example 7 ptotted with the
simulation, and shows ttiat the model fits the experimental data very well. In some cases the current
is smaller than predicted, however tills has been shown to be caused by ferrocene degradation which
may be remedied in a number of ways. However. Equation 1 1 does not Incorporate ttie effect of
electron transfier rate nor of instniment factors. Electron transfer rate is important when ttie rate is
dose to orlower than tfte applied frequency. Thus, the true i«: should be a function of aD ttiree. as
depicted in Equation 12.

wo 99/57317

Equation 12
Iac = f(Nemst factors)f(kCT)f(instfument factors)

FCTAJS99/10104

These equations can be used to model and predict the expected AC cun-ents in systems which use
5 input signals comprising both AC and DC components. As outlined above, traditional theory
surprisingly does not model these systems at all. except for very low voltages.

. In general, non-specifically bound label probes/ETMs show differences in impedance {le. higher
impedances) than when the label probes containing the ETMs are specifically bound in the correct
10 orientation. In a preferred embodiment, the non-specificafly bound material is washed away, resulting
in an effective impedance of infinity. Thus. AC detection gives several advantages as is generally
discussed below, including an increase in sensitivity, and the ability to "filter out" background noise. In
particular, changes in impedance (including.. for example, bulk impedance) as between non-specific
binding of ETM-containing probes and target-specific assay complex formation may be monitored.

Accordingly, when using AC initiation and detectfon methpds, the frequency response of the system
changes as a result of the presence of the ETM. By "frequency response" herein is meant a
modification of signals as a result of electron transfer between the electrode and the ETM. This
modification is different depending on signal frequency. A frequency response ir^cludes AC cunBnts at
20 one or more frequencies, phase shifts, DC offeet voltages, faradaic impedance, etc.

Once the assay complex including the target sequence and label probe is made, a first input electrical
signal is then applied to the system, preferably via at least the sample electrode (containing the .
complexes of the invention) and the counter electrode, to initiate electron transfer between the

25 electrode and the ETM; Three electrode systems may also be used, with the voltage applied to the

reference and woridng electrodes. The first input signal comprises at least an AC component The AC
component may be of variable amplitude and frequency. Generally, for use in the present methods,
the AC ampfitude ranges from about 1 tff/ to about 1.1 V, with firom about 10 mV to about 800 mV
being preferred, and from about 10 mV to about 500 mV being especially preferred. The AC

30 frequency ranges from about 0.01 rtc to about 100 MHz, vwth from about 10 Hz to about 10 MHz being
preferred, and from about 100 Hz to about 20 MHz being especially prefe^

The use of combinations of AC and DC signals gives a variety of advantages, including surprising
sensitivity and signal maximization.

In a preferred embodiment, the first input signal comprises a DC component and an AC component
That is. a DC offset voBage between the sample and counter electrodes is swept through the

WOW/57317 PCT/US99/10104

electrochemical potential of the ETM (for exanripre. when ferrocene is used, the sweep is generally .
from 0 to 500 mV) (or altematively, the working electrode is grounded and the reference electrode is
swept from 0 to -500 mV)- The sweep is used to identify the DC voltage at which the maximum
response of the system is seen. This is generally at or about the electrochemical potential of the ETMJ
5 Once this voltage is determined, either a sweep or one or more unifbrni DC offeet voltages may i>e

used. DC offeet voltages of from about -1 V to about +111 V are preferred, with from about -500 mV to
about +800 mV being especially preferred, and from about -300 mV to about 500 mV being particularly
prefen-ed. In a prefenred embodiment, the DC offset voltage is not zero. On top of the DC offset
voltage, an AC signal component of variable amplitude and frequency is applied. If the ETM Is
10 present, and can respond to the AC perturbation, an AC current will be produced due to electron
transfer between the electrode and the ETM. -

For defined systems, it may be sufficient to apply a single input signal to differentiate between the
presence and absence of the ETM (i.e. the presence of the target sequence) nucleic add.
15 Altemativeiy, a plurality of input signals are applied. As outlined herein, this may take a variety of

hftns, including using multiple frequencies, multiple DC offset voltages, or multiple AC amplitudes, or
combinations of any or all of these.

Thus, in a preferred embodiment, multiple DC offset voltages are used, although as outlined above,
20 DC voltage sweeps are preferred. Thismay be done at a single frequency, or at two or more
frequencies .

In a preferred embodiment the AC amplitude is varied. Without being bound by theory, it appears that
increasing the amplitude increases the driving force. Thus, higher ampFitudes, whk^h result in higher^

25 overpoferitials give fester rates of electron transfer Thus, generally, the same system gives an
improved response (i.e. higher output signals) at any single frequency through the use of higher
oyerpotentials at that frequency. Thus, the amplitude may be increased at high frequencies to
increase the rate of electron fransfer through the system, resulting in greater sensitivity. In addition,
this may be used, for. example, to induce responses in slower systems such as those that do not

30 possess optimal spacing configurations.

In a preferred embodiment, measurements of the system are taken at at least two separate arnplitudes
or overpotentials, with measuremente at a plurality of ampfitudes being preferred. As noted above,
charges in response as a result of changes in ampBtude may form the basis of klentification,
3 5 cafibration and quantifteatfon of the system. In addition, one or more AC frequendes can be used as .

wo 99/57317 PCTAJS99/10104
. rn a preferred embodiment; the AC frequency is varied. At different ffequencies. different molecules
respond in different ways. As will be appreciated by those in the art, increasing the frequency
(generally increases the output cunrent Howeyer, when the frequency is greater than the rate at which
. electrons may travel between the electrode and the ETM, highei' frequencies result in a loss or
decrease of output signaL At some point, the frequency will be greater than the rate of electron
transfer between the ETM and the electrode, and then the output signal will also drop.

In one embodiment, detection utilizes a single measurenr^ent of output signal at a single frequency.
That is. the frequency response of the system in the absence of target sequence, and thus the
absence of label probe containing ETMs, can be previously determined to be very low at a particular
high frequency. Using this infomnation, any response at a particular frequency, will show the presence
of the assay complex. That is, any response at a particular frequency is characteristic of the assay
complex. Thus, it may only be necessary to use a singfe input high frequency, and any changes in
frequency response is an indication that the ETM Is present, and thus that the target sequence is
present

In addition, the use of AC techniques allows the significant reduction of background signals at any
single frequency due to entities other than the ETMs, Le. "locking puf or "filtering' unwanted signals.
That is. the frequency response of a charge canier or redox active molecule in solution will be limited
by its diffusion coefficient and charge transfer coefficient Accordingly, at high frequencies, a charge
carrier may not diffuse rapidly enough to transfer its charge to the electrode, and/or the charge transfer
kinetics may not be fast enough. This is particularty significant in embodiments that do not have good
monolayers, i.e. have partial or insufficient monolayers, l.e. where the solvent is accessible to the
electrode. As outiined above, in DC techniques, tiie presence of "holes' where the electrode is
accessible to the soh^ent can resuK in solvent charge caniers "short circuiting' ttie system, i.e. the
reach the electrode and generate background signal. However, using the present AC techniques, one
or more frequencies can be chosen that prevent a frequency response of one or mbrie charge carriers
in solution, wheflier or not a monolayer is present This is particularly significant since many btotogical
fluids such as blood contain significant amounts of redox active molecMles whteh can interfere wiOi
amperometric detection methods.

In a preferred embodiment, measurenr^nts of tiie system are taken at at least two separate
frequendes, witt> measurenoents at a plurality of firequendes being preferred. A plurality of
frequencies includes a scan. For example, measuring tiie output signal, e.g., the AC cunBrit, at a low
Input frequency such as 1 - 20 Hz, and comparing tiie response to \he output signal at high frequency
such as 10 - 100 kHz will show a frequency response difference between ttie presence arid absence

wo 99/57317 PCrAJS99/]0]04

Of the ETM. In a prefenred embodiment, the frequency response Is^detenmined at at least two.
preferably at least about five, and more preferably at least about ten frequencies.

After transmitting the Input signal to Initiate electron transfer, an output signal is received or detected.
The presence and magnitude of the output signal will depend on a number of factors. Including the
overpotentlal/amplltude of the input signal; the frequency of the input AC signal; the composition of the
intervening medium; the DC offeet; the environment of the system; the nature of the ETM; the solvent;
and the type and concentration of salt At a given Input signal, the presence and magnitude of the
output signal will depend in general on the presence or absence of the ETM, the placement and
distance of the ETM from the surface of the monolayer and the character of the input signal. In some
embodiments. It may be possible to distinguish between non-specific binding of label probes and the
(brmatlon of target specific assay complexes containing label probes, on the basis of impedance.

In a preferred embodiment, the output signal comprises an AC current As outlined above, the
magnitude of the output current will depend on a number of parameters. By varying these parameters,
the system may be optimized In a number of ways.

In general, AC currents generated in the present invention range from about 1 femptoamp to about 1
milliamp. with cunrents from about 50 femptoamps to about 100 microamps being preferred, and from
about 1 picoamp to about 1 microamp being especially preferred.

In a preferred embodiment the output signal is phase shifted in the AC component relative to the input
signal. Without being bound by theory, it appears that the systems of the present Invention may be
sufficiently unifbrrti to allow phase-shifting based detection. That is. the complex biomolecules of the
invention through which elecfron. transfer occurs react to the AC Input in a homogeneous manner,
similar to standard electronic components, such that a phase shift can be determined. This may serve
as the basis of detection between the presence and absence of the ETM, and/or diflefen(»s between
the presence of target-specific assay complexes comprising label probes and non-specific binding of
the label probes to the system components.

The output signal is characteristic of the presence of the ETM; that is. the output signal is
characteristic of the presence of the target-specific assay complex comprising label probes and ETMs.
In a prefenred embodiment the basis of the detect

system as a resuS of the formation of the assay complex. Faradaic impedance is the Impedance of
the system between the electrode and the ETM. Faradaic impedance Is quite different frbm the bulk .
or dielecfric impedance, which Is the impedance of the bulk solution between the electrodes. Many
factors may change the faradaic impedance which may not effect the bulk Impedance, and vfce versa.

wo 99/57317 PCT/US99/10ia4

Thus, the assay complexes romprising the nucleic adds in this systenri have a certain faradaic
impedance, that will depend on the distance t)etween the ETM and the electrode, their electronic
properties, and the composition of the intervening medium, among other ttiings. Of importance in the
methods of the invention is that the Gradate impedance between the ETM and the electrode Is
5 signficantly different depending on whether the label probes containing the ETMs are specifically or
non-specifically bound to the electrode.

Accordingly, the present invention further provides apparatus for the detection of nucleic adds using
AC detection methods. The apparatus includes a test chamber which has at least a first measuring or
10 sample electrode, and a second measuring or counter electrode. Three electrode systen^ are also
useful. The first and second measuring electrodes are in contact with a test sample receiving region,
such that in the presence of a liquid test sample, the two electrodes may be in electrical contact

In a preferred embodiment, the first measuring electrode comprises a single stranded nucleic add
15 capture probe covalently attached via an attachment linker, and a monolayer comprising conductive
oligomers, such as are described herein.

The apparatus further comprises an AC voltage source elTCtrically connected to the test chamber, that
. is, to the measuring electrodes. Preferably, the AC voltage source is capable of delivering DC offset
20 voltage as wen.

In a preferred embodiment, the apparatus further comprises a processor capabJe of comparing the
input signal and the output signal. The processor is coupled to the electrodes and configured to
receive an output signal, and thus detect the presence of the target nudeic add.

Thus, the compositions of the present invention may be used in a variety of research, dinical, quality
control, or field testing settings.

In a preferred embodiment the probes are used In genetic diagnosis. For example, probes can be
30 rnade using the techniques discbsed herein to detect target sequences such as the gene for

nonpolyposis colon cancer, the BRCA1 breast cancer gene, P53, which Is a gene associated with a
variety of cancers, the Apo E4 gene that indicates a greater risk of Alzheimer's dise^e, altowing for
easy presymptomatic screening of patients, mutatfons in the cystic fibrosis giene, or any of the others
wen kriown in the art v , ^

In an additional embodiment viral and bacterial detectton is done using the complexes of the
invention. In this embodiment probes are designed to detect target sequences from a variety of

wo 99/57317 PCT/US99/10104
bacteria and vhruseis. For example, current blood-screenfng techniques rely on the detection of antl-
HIV antibodies. The methods disclosed herein allow for direct screening of clinical samples to detect
HP/ nudeic acid sequences, particularty highly cbnseived HIV sequences. In addition, this allows
direct monitoring of drculating virus within a patient as an Improved method of assessing the efficacy
of anti-viral therapies. Simllarty . viruses associated with leukemia, HTLV-I and HTLV-II, may be
detected in this way. Bacterial Infections such as tuberculosis, clymidia and other sexually transmitted
diseases, may also be detected.

In a prefen^ed embodiment, the nucleic acids of the Invention find use as probes for toxic bacteria In
the screening of water and food samples. For example, samples may be treated to lyse the bacteria
to release its nudeic add. and then probes designed to recognize bacterial strains, including, but not
limited to, such pathogenic strains as, Salmonella, Campylobacter, Vibrio choleme, Leishmania,
enterotopcic strains of E cdi, and Legionnaire's disease bacteria. SImilarty. bioremediation strategies
may be evaluated using the compositions of the invention.

In a ftjrther embodiment the probes are used for forensic "DMA fingerprinting" to match crime-scene
DNA against samples taken from victirTO and suspects.

In an additional embodiment, the probes in an array are used for sequencing by hybridizatton.

Thus, the present Invention provides for extremely specific and sensitive probes, which may, in some
embodlnrrents. detect target sequences vi^ithout removal of unhybridized probe. This will be useful in
the generation of autonr^ted gene prot)e assays.

Alternatively, the compositfons of the Inventton are usefUl to detect successful gene amplification Iri
PCR, thus allowing successful PGR reactions to be an Indkation of the p^ -
target sequence. PGR may be used in this manner in several ways. For example, in orte
en*odiment, the PGR reaction is done as is known in the art and then added to a composition of the
invention comprising the target nucleic add with a ETM, covalentfy attached to an electrode via a
conductive oligomer wiBi subsequent detection of the target sequence. Alternatively, PGR is done
using nucleotides labelled with a ETM. eitiier in tiie presence of. or wiUi subsequent addition to, an
etedrode with a conductive oligomer Binding ofttie PGR product containing

ETMs to the electrode composition wiB altow detection via electron transfer. Finally, the nudeic add
attached to the electrode via a conductive polymer may be one PGR primer, witti addition of a second
primer labelled with an ETM. Elongation results in double stranded nucleic add with a ETM
and electrode covalentty attached. In this wgy. the present invention is used for PGR detection of
target sequences.

wo 99/57317 PCTAJS99/10104

In a preferred embodiment, the arrays are used for mRNA detection. A preferred emt)odiment utilizes
either capture probes or capture extender probes that hybridize close to the 3' polyadenylation tail of
thef mRNAs. This allows the use of one species of target binding probe for detection, l.e. the probe
contains a poV-T portion that will bind to the poly-A tail of the mRNA ta^ Generally, the probe will
5 contain a second portion, preferably non-poly*T, that will bind to the detection probe (or other probe).
This allows one target-binding probe to be made, and thus decreases the amount of different probe
synthesis that is done.

In a preferred embodiment, the use of restriction enzymes and ligation methods allows the creation of
10 "universar an^ys. In this embodiment, monolayers comprising capture probes that comprise

restriction endonuclease ends, as is generally depicted in Figure 39. By utilizing complementary
portions of nucleic acid, while leaving "sticky ends", an array comprising any number of restiiction
endonuclease sites is made. Treating a target sample wrtii one or more of Uiese restriction
endonucleases allows the targets to bind to tiie array. This can be done witiiout knowing the
15 sequence of the target The target sequences can be ligated. as desired, using standard metiiods

such as figases, and tiie target sequence detected, using either standard labels or tiie metiiods of the
invention.

The present invention provides metiiods which can result in sensitive detection of nudefe ackis. in a
2 0 preferred embodiment, less than about 10X10^ nK>lecules are detected, witii less tiian about 10X10^
being preferred, less tiian 10 X 10^ being particularly preferred, less than about 10X10^ being
especially preferred, and less than about 10X10^ being most preferred. As will be appreciated by
those in tiie art, this assumes a 1:1 correlation between target sequences and reporter molecules; if
more than one reporter molecule (i.e. electron transfer moeity) is used for each target sequence, the

2 5 sensitivity will go up.

While the Rmits of detection are currentty being evaluated, based on the published electron transfer
rate through DMA, whk:h is rougltly 1X10^ electrons/sec/duplex foran 8 base pair separation (see
Meade et at:, Angw. Chera Eng. Ed., 34:352 (1995)) and high driving forces, AC frequenciets of about
30 100 kHz should be possible. As the preliminary results showr, electron transfer tiirotigh these systems
is quite efficient resulting in nearly 100 X lO' electrons/sec; resulting in potential femptoamp sensitivity
for very few molecules.

The foBowing examples serve to more ifully describe the manner of using the above-described

3 5 invention, as vjrell as to set forth the best modes contemplated for carrying out various aspects of the .

invention, it ts understood tiiat these examples in no way serve to iinrut the true scope of tills invention.

WOW/57317

but rather are presented for illustrative purposes,
reference in their entireity. . ;

PCTAJS99/10104
All references cited herein are incorporated by

EXAMPLES
Example 1

Synthesis of nucleoside modified with ferrocene at the 2* position
The preparation of N6 is described as shown in Figure 9.

Compound N1. Ferrocene (20 g, 108 mmol) and 4-bromobutyl chloride (20 g, 108 mmol) were
dissolved in 450 mL dichloromethane followed by the addition of AICI3 anhydrous (14.7 g. 1 1 mmol).
The reactfon mixture was sHn^d at room temperature for 1 hour and 40 minutes, then was quenched
by additbn of 600 mL ice. The organic layer was separated and was washed with water until the
aqueous layer was close to neutral (pH = 6). The organic layer was dried with Na2S04 and
concentrated. The crude product was purified by flash chronrtatography eluting with 50/50
hexane/dichloromethane and later 30/70 hexane/dlchloromethane on 300 g silica gel to afford 26.4
gm (73%) of the title producL

Compound N2. Compound N1 (6 g. 18 mmol) was dissolved In 120 mL toluene in a round bottom
flask, zinc (35.9 g, 55 mmol). mercuric chloride (3.3g, 12 mmol) and water (100 mL) were added
successively. Then HCI solution (12 M. 80 mL) was added dropwise. The reaction mixture was
stirred at room temperature for 16 hours. The organic layer was separated, and washed with water (2
X 100 mL) and concentrated. Further purification by flash chromatography (hexane) on 270 gm of
silica gel provided the desired product as a brown solid (3.3 g, 58%).

Compound N3. A mixture of 13.6 gm (51 mmol) of adenosine in 400 mL dry DMF was cooled In a
reenter bath for 10 minutes before the addition of 3.0 gm (76 mmol) of NaH (60%) . The reaction
mixture was stin^ at 0 ^C for one hour before addition of Compound N2 (16.4 g, 51 mmol) Then
the temperature was slowly raised to 30 'C. and the reaction mixture was kept at this temperature for

4 hours before being quenched by 100 mL ice. The solvents were removed in vacuo. The resultant
gum was dissolved in 300 mL water and 300 mL ethyl acetete. The aqueous layer was extracted
Uioroughly (3 x 300 mL ethyl acetete). The combined organfe extracts were concentrated, and the
crude product was purified by flash chromatography on 270 g sIHca gel. The column was eluted with
20%elhyl acetete/dfchtoromethane, 50 % ethyl acetate/dk^foromethane, 70 % ethyl
acetate^dichtoronriethane, ethyl acetete, 1 % n^eUiariol/ethyl acetete, 3 % methanoVethyl acetete, and

5 % mettianoVethyl acetete. The concentration of the desired fractions provide ttie final product (6.5 g,
25%).

wo 99/57317 PCT/US99/10104
Compound N4. Compound n3 (6.5 g. 12.8 mmol) was dissolved in 150 mL dry pyridine, followed by
adding TMSCI (5.6 g. 51.2 mmol) . The reaction mixture was stirred at nx)m temperature for 1.5
hours. Then phenoxyacetyl chloride (3.3 g. 19.2 mmol) was added at 0 •C. The reaction was then
stinred at room temperature for-4 hours and was quenched by the addition of 100 mL water at 0 "0.
5 The solvents were removed under reduced pressure, and the crude gum was further purified by flash
chromatography on 90 g of silica gel (1 % methanol/dichloromethane) (2.3 g. 28%).

Compound N5. Compound N4 (2.2 g. 3.4 mmol) and DMAP (200 mg, i.6 mmol) were dissolved in
150 mL dry pyridine, followed by the addition of DMTCI (1.4 g, 4.1 mmol). The reaction was stined
10 under argon at room temperature ovemight The solvent was removed under reduced pressure, and
the residue was dissolved in 250 mL dichloromethane. The organic solution was washed by 5%
NaHCOa solution (3 x 250 mL) , dried over Na2S04. and concentrated. Further purification by flash
chrornatography on 55 g of silica gel (1 % TEA/50% hexane/dichioromethane ) provided the desired
product (1.3 g, 41%).

Compound N6. To a solution of N5 ( 3.30 gm. 3.50 mmol) in 150 mL dichloromethane.
Diisopropylethylamine (4.87 mL, 8.0 eq.) and catalytic amount of DMAP (200 mg) were added. The
mixture was kept at 0 and N, N-diisopropylamino cyanoeftyl phosphonamidic chloride (2.34 mL.
10.48 mmol) was added. The reaction mixture was wanned up and stirred at room temperature

2 0 ovemight After dilution by adding 1 50 mL of dichloromethane and 250 mL of 5 % NaHCOj aqueous
solution, the organic layer was separated, washed with 5% NaHC03 (250 mL), dried over Na2S04.
and concentrated. The crude product was purified on a flash column of 66 g of silica gel packed with
1 % TEA in hexane. The eluting solvents were 1 % TEA in hexane (500 mL). 1 % TEA and 1 0%
dichtorometiiane in hexane (500 mL). 1 % TEA and 20% dich toromethane in hexane (500 mL). 1 % .

25 TEA and 50% dichloromethane in hexane (500 mL). Fractions containing the desired products were
colleded and concentated to afford the final product (3 gm. 75%).

; . Exkvnptel. .
Synthesis of "Branched" nucleosMe

The synthesis of N17 is descril>ed as shown in Rgure 10.

Synthesis of N14. To a solution of Tert-butyldimethylsily chloride (33.38 g. 0.22 mol) in 300 mL of
. dichtorpmethane was added imidazole (37.69 g. 0.55 mol) . Immediately, large anrount of precipitate
35 was.fbnned. 2-Brornoethanol (27.68 g. 0.22 mol,0 was added stowly at room temperafe^^ The

reaction inbcture was stirred at this temperature for 3 hours. The organic layer was washed with water

wo 99/57317 PCT/US99/10ia4

(200 mL). 5% NaHCOa (2 x 250 mL). and water (200 mL). The removal of solvent afforded 52:52 g of
the title product (99%).

Synthesis of N15. To a suspension of adenosine (40 g, 0.15 mol) In 1.0 L of DMF at 0 •C, was
added NaH (8.98 gm of 60% In mineral oil, 0.22 mol). The mixture was stirred at 0 for 1 hour, and
N14 (35.79 gm. 0.15mol) was added. The reaction was stirred at 30 overnight It vi^s quenched
by 1 00 mL ice-water. The solvents were removed under high vaccum. The resultant foam was
dissolved In a mixture of 800 mL of ethyl acetate and 700 mL of water. The aqueous layer was further
extracted by ethyl acetate ( 3 x 200 mL). The combined origanic layer was dried over Na2S04 and
concentrated. The crude product was further purified on a flash column of 300 g of silica gel packed
with 1% TEA in dichloromethane. The eluting solvents were dichloromethane (500 mL), 3% MeOH in
dichloromethane (500 mL). 5% MeOH in dichloromethane (500 mL). and 8% MeOH in
dichloromethane (2000 mL). The desired fractions were collected and concentrated to afford 11.70 g
of the title product (19%).

Synthesis of N16. To a solution of N15 (11.50 gm. 27.17 mmol) in 300 mL dry pyridine cooled at 0
*»C. was added Irimethylsily chloride (13.71 mL. 0.11 mol. 4.0). The mixture was stirred atO'C for 40
min. PhenoxyacetyI chloride (9;38mL. 67.93 mmol) was added. The reaction vifasstinred at O'C for
2.5 h. The mbdure was.lhen transferred to a mixture of 700 mL of dichloronnethane and 500 mL water.
The mbctur^ was shaken well and organic layer was separated. After washing twice with 5% NaHCOj
(2x 300mL), dichloromethane was removed on a rotovapor. Into the residue was added 200 mL of
water, the resulting pyridine mixture was stirred at room temperature for 2 hours. The solvents were
then removed under high vacuum. The gum product was co-evaporated with 100 mL of pyridine. The
residue was dissolved in 250 mL of dry pyridine at 0 *^C, and 4, 4*Klimethoxytrityi chloride (11.02 gm.
32.60 mmol) was added. The reaction was stirred at room temperature ovemighL The solution was
transferred to a mixture of 700 mL of dichloromethane and 500 mL of 5% NaHCOg. After shaking wen,
the organic layer was separated, further washed with 5% NaHCC^ (2 x 200 mL), and then
concentrated; The crude product vras purified on a flash column of 270 gm of silica gel packed with
1% TEAO0% CHaCyHexane. The eluting soh^ente were 1% TEA/ 50% CH^CyHexane (1000 mL).
and 1% TEA /CHaCij (2000 mL). The fractfons containing the desired product were collected and
concentrated to afford 10.0 g of the title product (43%).

Synthesis of N17. Toasolutionof N1 6 (10.0 gm. 11.60 mnrtol) in 300 mL dichloromethane.
Diisopropylethylamine (16.2 mL) and catalytic amount of N. N-dimethylaminopyridine(200 mg) were
added. The mixture was cooled in an ice-water bath, and N. I^HSopropyte^^
phosphonamidic chloride (7.78 mL. 34.82 mmol) was added. The reaction was sGnred at room
temperature overnight The reactkm mixture was diluteld by adding 250 mL of dichtoromethane and
250 rhL of 5% NaHCOj. After shaking well, the organte layer was separated and washed once more
with the same amount of 5 % NaHCOsaqueous solution, dried over Na2S04. and concentrated. The

wo 99/57317 PCTAJS99/10ia4

crude prcxluct was purified on a flash column of 120 gm of silica gel packed with 1% TEA and 10%
dichloromethane in hexane. The eluting solvents were 1% TEA and 10% drchloromethahe In hexane
(500 mL), 1 % TEA and 20% dichloromethane in hexane (500 mL), and 1 % TEA and 40%
dichloromethane in hexane (1500 mL). The right fractions were collected and concentrated to afford
the final product (7.37gm. 60%).

Example 3

Synthesis of nucleoside with ferrocene attached via a phosphate

The synthesis of Y63 is descril)ed as shown in Figure 11.

Synthesis of C102i A reaction mixture consisting of 10.5gm (327 mmol) of N2, 16gm of potassium
acetate and 350 ml of DMF was stirred at lOffC for 2.5hrs. The reaction mixture was allowed to cool

15 to room temperature and then poured into a mixture of 400ml of ether and 800ml of water. The

mixture was shaken and the organk; layer was separated. The aqueous layer was extracted Wince
with ether. Vhe cortibined ether extracts were dried over sodium suWaXe and then concentrated for
column chromatography. Silica gel(160 gm) was packed with 1% TEA/Hexane. The crude Was k)aded
and the column was eluted with 1 % TEA/0-100 % CHjGlj/Hexane. Fractions containing desired

2 0 product were collected and concentrated to afford 5.8g (59.1 %) of C102.

, Svnthesls of Y61: To a flask containing 5.1gm (17.0 mmol) of C102 was added 30ml of Dioxane. to
this solution, small aliquots of 1 M NaOH was added over a period of 2.5 hours or until hydrolysis was
complete. After hydrolysis the product was extracted using hexane. The combined extracts were .

2 5 dried over sodiuni sulfate and concentrated for chromatography. Silica gel (1 00 gm) was packed in

1 0% EtOAc/ Hexane. The cmde product solution was toaded and the column was eluted with 1 0% to
50% EtOAc in hexane. The fractfons containing desired product were pooled and concentrated to
afford 420 gm (96.1 %) of Y61.

3 0 Synthesis of Y62: To a flask containing 4. 10 gm (1 5.9 mrhol) of Y61 was added 200ml of .

dichtoromethane and 7.72 ml of DIPEA and 4.24 gm (15.9 mmol) of bis(diisopropylamino)
chlorophosphine. This reaction mixture was stin^ under the presence of argon overnight After the
reaction mixture was concentrated to 1/3 of its original volume. 200ml of hexane was added and then
the reaction mixture was again concentrated to 1/3 is original volume. This procedure was repeated
3 5 once more. The precipitated salts were filtered off and the sotutk)n was concentrated to afford 8.24gm
of crude Y62. Without further purification, the product was used for next step.

wo 99/57317 PCT/US99/10104
Synthesis of Areactioiunixtureotl.O-gm (1.45 mmol) of N-PAC deoxy-adenosine. 1.77g of the
crude ¥62. and 126mg of N. N-diisopropylammonium tetrazolide, and 100 ml of dichloronnethana The
reaction nnixture was stirred at room temperature overnight The reaction mixture was then diluted by
adding lOOmi of CH2CI2 and 100 ml of 5% NaHCOg solution. The organic phase was separated and
, 5 dried over sodium sulfate. The solution was then concentrated for column chronoatography. Silica gel
(35 gm) was packed with 1 % TEA /Hexane. The crude material was eluted with 1 % TEA 710-40%
. CH2CI2 / Hexane. The fractions containing product were pooled and concentrated to afford 0.25 gm of
the title product

10 Example4

Synthesis of Ethylene Glycol Terminated VVire W71

As shown in Figure 12. ;

Synthesis of W?5: To a flask was added 7.5 gm (27.3 mmol) of ferf-butyldiphenylchlordsilane. 25.0
15 gm (166.5 mmol) of tri(ethylene glycol) and 50 ml of dry DMF under argon. The mixture was stirred
and cooled in an ice-water bath. To the flask was added dropwise a clear solutfon of 5.1 gm (30.0
mmol) of AgNOg in 80 ml of DMF through an additional funnel. After the completeness of addition, the
mixture was altowed to warm up to room temperature and was stirred for additional 30 min. Brown
AgCI precipitate was filtered out and washed with DMF(3 x 1 0 ml). The removal of solvent under
2 0 reduced pressure resulted in formation of thick syrup-like liquki product that was dissolved In about 80
ml of CH2CI2. The solution was washed with water (6 x 100 mL) in order to remove unreacted starting
material, le. tris (ethylene glycol), then dried over NajSOI. Removal of CH2CI2 afforded - 10.5 g crude
product, whk:h was purified on a column containing 1 04 g of silica gel packed with 50 %
CHzClj/hexane. The column was eiuted wifli 3-5% MeOH/ CH2CI2. The fractions containing the

2 5 desired product were pooled and concentrated to afford 8.01 gm (75.5 %) of the pure title product

Synthesis of vysg: To a flask containing 8.01 gm (20.6.0 mmol) of W55 was added 8.56 gm (25.8
mmol) of CBr4 and 60 ml of CH2CI2* The mixture was stin^ in an fce-^water bath. To the solution was
stowly added 8.1 1 gm (31.0 mnrwl) of PPhj in.15 ml CH^Ct The mixture was stirred for about 35 min.

3 0 at 0 ^ , and allowed to wanm to room temperature. The volume of the mixture was reduced to about

10.0 ml and 75 ml of ether was added. The precipitate was filtered out and washed wfth 2x75 of .
ether. Removal of ether gave about 15 gm of crude product that was used for purification. Silica gel
(105 gm) was packed with hexana Upon toading the sample solution, the column was eluted with 50
% CHsCI^/hexane and then CH2CI2. The desired fractions were pooled and concentrated to give
35 8.56gm(7Z0 %) of pure t'tle product

wo 99/57317 PCT/US99/10ia4
Synthesis of W69 : A solution of 5.2 gm (23.6 mmol)of 4-lodophenol In 50 ml of dry DMF was cooled
in an Ice-water bath under Ar. To the mixture was added 1 .0 gm of NaH (60% in mineral oil, 25.0
mrnol) portion by portion. The mixture was stirred at the same temperature for about 35 min. and at
room temperature for 30 min. A solution of 8.68 gm (19.2 mmol) of W68 in 20 ml of DMF was added
5 to the flask under argon. The mixture was stirred at 50 *C for 12 hr with the flask covered with

aluminum foil. DMF was removed under reduced pressure. The residue was dissolved In 300 ml of
ethyl acetate, and the solution was washed with HjO (6 x 50 mL). Ethyl acetate was removed under
reduced pressure and the residue was loaded into a 100 g silica gel column packed with 30 %
CHjClj/hexane for the purification. The column was eluted with 30-1 00% CHjClj/hexane. The
1 0 fractions containing the desired product were pooled and concentrated to afford 9.5 gm (84.0 %) of the
title product

Synthesis of W70: To a 1 00 ml round bottom flask containing 6.89 gm (1 1 .6 mmol) of W69 was
added 30 ml of 1M TBAF THF solution. The solution was stin^d at room temperature for 5h. THF
15 was removed and the residue was dissolved 150 ml of CHjClj. The solution was washed with HjO (4 x
25 ml). Removal of solvent gave 10.5 gm of semi-solW. Silfca gel (65 gm) was packed with 50 %
CHjCla/hexane, upon toading the sample solutk>n, the column was eluted with 0-3 % CH3OH/CH2CI2.
The fractions were identified by TLC (CH3OH : CHjCt = 5 : 95). The fracfions containing the desired
product were collected and concentrated to afford 4.10 gm (99.0% ) of the title product

Syr^thesls ofW71:To a flask was added 1.12 gm (3.18 mmol) of W70, 0.23 g (0.88 mmol) of PPhj,
1 10 mg (0.19 mmol) of Pd(dba)2. 1 10 mg (0.57 mmol) of Cul and 0.75g (3.2 mmol) of Y4 (one unit
wire). The flask was flushed with argon and then 65 ml of dry DMF was introduced, followed by 25 ml
of dilsopropylamine. The mixture was stinred at 55 for 2.5 h. All tsolvents were removed under

25 reduced pressure. The residue was dissolved in 100 ml of CHjClj. and the solution was thoroughly
washed with the saturated EDTA solution (2 x '100 mL). The Removal of CH2CI2 gave 2.3 g of crude
product Silica gel (30 gm) was packed with 50 % CHjCla/hexane, upon loading the siample solutfon,
the column was eluted with 10 % ethyl acelate/rcHjClj. The concentratbn of the fractions containing
flie desired produd gave1.35 gm (2.94 mmol) of the Btie product, which was furft^

30 recrystalGzation from hot hexane solution as 00 torless crystals.

Examples

Syntiiesis of nucleoside attached to an insulator

35 As shown in Rgure 13. -

Synthesis of C108: To a flask was added 2.0grh (3.67 mmol) of r-amino-S'-O-DMT uridine, 1 .63gm
{3.81 mmol) of C44, 5nfil of TEA and 100ml of dichloromettiane. This reaction mixture was stin^ed at

wo W/573I7 PCT/US99/10104

room temperature over for 72hri5. The solvent was removed and dissolved In a small volume of
CHjCt Silica gel (35 gm) was packed with 2% CHJ0W1% TEA/CHjClj. upon loading the sample
solution, the column was eluted with the same solvent system. The fractions containing the desired
product were pooled and concentrated to afford 2.5gm ( 80.4 %) of the title product

Synthesis of C109: To a flask was added 2.4gm ( 2.80 mmol) of CI 08, 4ml of diisopropylethylamine
and 80ml of CH2CI2 under presence of argon. The reaction mixture was cooled in an ice-water bath.
Once cooled, 2. 1 0 gm (8.83 mmol) of 2-cyanoethyl diisopropylchloro-phosphoramidile was added.
The mixture was then stin-ed ovemight. The reaction mixture was diluted by adding 10ml of methanol
10 and 150mt of CI-I2C12* This mixture was washed with a 5% NaHCO, solution, dried over sodium sulfiate
and then concentrated for column chromatography. A 65gm-silica gel column was packed in 1% TEA
and Hexane. The crude product was loaded and the column was eluted with 1 % TEA/ 0-20 %
CHzCls/Hexane. The fractions containing the desired product were pooled and concentrated to afford
2.69gm (90.9 %) of the title product

Examples

Synthesis of an electrode containing capture nucleic acids containing
conductive oligomers and insulators

20 Using the above techniques, and standard nucleic acid synthesis, capture probes comprising a

conductive oligomer were made (hereinafter "wlre-l"). Conductive oligomers with acetylene tennini
were made as outlined herein (herenriafter"wire-2'7.

HS-(CH2}16-OH (herein "insulator-2") was made as follows.

25 . ■ • .

16-Bromohexadecanofc acid. 16-Bromohexadecdnoic add was prepared by refluxing for 48 hrs 5.0
gr (18.35 mmole) of 16-hydroxyhexadecanoic add in 24 ml of 1:1 v/V mixture of HBr (48% aqueous
solution) and glacial acetic acid. Upon cooling, cmde product was solidified inside the reaction vessel.
It was filtered out and washed with 3x100 ml of cold water. Material was purified by recrystalization

3 0 from n-hexane, filtered out and dried on high vacuum. 6.1 gr (99% yield) of the desired product were
obtained.

16-Mercaptohexadecanoic acid. Under inert atmosphere 2.0 gr of sodium metal suspenston (40% in
mineral oil) were stowly added to 1 0d ml of dry methanol at O'^C. At the end of the additfon reaction
3 5 mbclure was stirred for 1 0 min at RT and 1 .75 ml (21 .58 mmole) of thioacetic add. were added: After .
addiHonal 10 min of stirring, 30 ml degassed methanortc solutbn of 6.1 gr (18.19 mmole) of 16-
bromohexadecanoic add were added. The resulted mbcture was refluxed for 15 hrs, after whid).

Wp99/57317 PCT/US99/10ia4

allowed to cool to RT and 50 ml of degassed 1.0 M NaOH aqueous solution were injected. Additional
refluxing for 3 hrs required for reaction completion. Resulted reaction mixture was cooled with ice bath
and poured, with stimng, into a vessel containing 200 ml of ice water This mixture was titrated to
pH=7 by 1 .0 M HCI and extracted with 300 ml of ether. The organic layer was separated, washed with
5 3x1 50 ml of water, 1 50 ml of saturated NaCI aqueous solution and dried over sodium sulfate. After
removal of ether material was purified by recrystalization from n-hexane, filtering out and drying over
high vacuum. 6. 1 gr (97% yield) of the desired product was obtained.

16-Bromohexadecan-1-ol. Under inert atmosphere 10 ml of BH^THF complex (1 .0 M THF solution)
10 were added to 30 ml THF solution of 2.15 gr (6.41 mmole) of 16-bromohexadecanoic acid at -20'*C.
Reaction mixture was stirred at this temperature for 2 hrs and then additional 1 hr at RT. After that
time the resulted mixture was poured, with stirring, into a vessel containing 200 ml of ice/saturated
sodium bicarbonate aqueous solution. Organic compounds were extracted with 3x200 ml of ether. The
ether fractions were combined and dried over sodium sul^te. After removaj of ether material was
15 dissolved in minimum amount of didoromethane and purified by sillcia gel chromatography (100%
dicloromethane as eluent). 1 .92 gr (93% yield) of the desired piquet were obtained.

16*IVIercaptohexadecan-1-ol* Under inert atmosphere 365 mg of sodium metal suspension (40% in
mineral oil) were added dropwise to 20 ml of dry methanol at 0*C. After completion of additi^^

20 reaction mixture was stin-ed for 10 min at RT followed by addition of 0.45 ml (6 30 mmole) of

thioacetic acid. After additional 10 min of stirring 3 ml degassed methanolic solution of 1.0 gr (3.11
mmole) of 16-bromohexadecan-1-ol were added. The resulted mbcture was refluxed for 15 hrs,
allowed to cool to RT and 20 ml of degassed 1.0 M NaOH aqueous solution were injected. The
reaction completion required additional 3 hr of reflux. Resulted reaction mixture was cooled with ice

25 bath and poured, with stim'ng, into a vessel containing 200 ml of ice water. This mixture was titrated to
pH=7 by 1 .0 M HCI and extracted with 300 ml of ether. The organic layer was separated, washed with
3x150 ml of water, 150 ml of saturated NaCI aqueous solution and dried over sodium sulfate. After
ether removal material was dissolved in minimum amount of dtdoroniethahe and purified by silica gel
chromatography (1(K)% dicloromethane as eluent). 600 mg (70% yield) of the desired product were

30 obtained:

A clean gold covered microscope slide was incubated in a solution containing 100 micromolar HS-
(Crf2)i6-COOH In ethanol at room temperature for 4 hours. The electrode was then rinsed throughly
with ethanol and dried. 20-30 microliters of wire-1 + wire-2 solution (1 micronwlar in 1XSSC buffer at
35 pH 7.5) was applied to the electrode in a round droplet The electrode was incubated at room

temperature for 4 hours in a nnoist chamber to minimize evaporation. The wire-1 solution was then

wo 99/57317 PCT/US99/10104

removed from the electrode and the electrode was immersed In 1XSSC buffer followed Ijy 4 rinses
with 1XSSC. The electrode was then stored at room temperature for up to 2 days in 1XSSC.

Altematively, and preferably, either a 'two-step" or "three-step* process is used. The "two-step"
procedure is as follows. The wire-1 + wire-2 mixture, in water at - 5-10 micromolar concentration, was
exposed to a clean gold surface and incubated for - 24 hrs. It was rinsed well with water and then
ethanol. The gold was then exposed to a solution of - 1 00 micromolar insulator thiol In ethanol for
12 hrs. and rinsed well. Hybridization was done with complement for over 3 hrs. Generally, the
hybridization solution was warmed to SO^C, then cooled in order to enhance hybridization.

The "three-step" procedure uses the same concentrations and solvents as above. The clean gold
electrode was incubated In insulator solution for - 1 hr and rinsed. This procedure presumably results
in an incomplete monolayer, which has areas of unreacled gold. The slide was then incubated with a
mixture of wire-1 and wlre-2 solution for over 24 hrs (generally, the tonger the better). These wires still
had the ethyl-pyridine protecting group on it. The wire solution was 5% NH40H, 15% ethanol in water.
This removed the protecting group from the wire and allowed it to bind to the gold (an In situ
deprotection). The slide was then incubated in Insulator again for - 12 hrs, and hybridized as above.

In general, a variety of solvent can be used including water, ethanol. acetonitrile. buffer, mixtures etc.
Also, the Input of energy such as heat or sonlcation appears to speed up all of the deposition
processes, although It may not be necessary. Also, it seems that longer Incubation periods for both
steps, for example as long as a week, the better the results.

Example 7
AC detection methods

Electrodes containing the different compositions of the invention were made and used in AC detection
methods. The experiments were run as follows. A DC offeet voltage between the worthing (sample)
electrode and the reference electrode was swept through the electrochemfcal
ferrocene, typically from 0 to 500 mV. On top of the DC offset an AC signal of variable amplitude and
frequency was appfied. The AC current at the excitation frequency was plotted versus the DC offeet

Examples
Comparison of Different ETM Attachments

wo 99/57317 PCT/US99n0104

A variety of different ETM attachments as depicted in Figure 15 were compared. As shown In Table 1 ,
a detection probe was attached to the electrode surface (the sequence containing the wire in the
table). Positive (I.e. probes complementary to the detection probe) and negative (i.e. probes not
complennentary to the detection probe) control label probes were added.

Bectrbdes containing the different compositions of the invention were made and used in AC detection
nnethods. The experiments were run as follows. A DC offset voltage between the working (sample)
electrode and the reference electrode was swept through the electrochemical potential of the
ferrocene, typically from 0 to 500 mV. On top of the DC offset, an AC signal of variable amplitude and
frequency was applied. The AC current at the excitation frequency was plotted versus the DC offset

The results are shown in Table 2. with the Y63. VI and IV compounds showing the best results.

Metal

Complexes

Redpx

Potential (mV)

10 Hz

100 Hz

1.000 Hz

10.000 Hz

400

Not clear

Not dear

350

0.15 M

0.01 mA

0.005 M

III {+ control)

360

0.025 M

0.085 AtA

0.034 fxA

III (- control)

360

0.022

0.080 AiA

0.090 A/A

140

0.34 M

3.0 juA

13:0a<A

35a<A

400

0.02 f<A

0.15 mA

Vl{1)

140

0.22 /<A

1.4^

4.4 A/A

8.8 M

Vl(2)

140

0.22 M

0.78 /iA

5.1 fiA

44 M

VII

320 ;

0.04 M

0.45 M

No Peak

VIII(not
purified)

360

0.047 pA

No Peak

Y63 ,

160

.25M

36M

130 M

Not dear There is no difference between positive control and negative control.
ND: Not determined

Table of the OilgonucleoQdes Containing Different Metal Complexes

Metal

Complexes

Positive Control Sequence Containing
Blletal Complexes and Numbering

Negative Control Sequence
Containing Metal Complexes and '
Numbering

5'-A(l)C (I)GA GTC CAT GGT^'
#D199:.1

5'-A(l)G (i)CC TAG CTG GTG-3'
#D200_1

wo 99/57317 PCT/US99/10i04

5 .

5'-A(ll)C (ll)GA GTC CAT GGT-3'
#D211_1.2

5'-A(ll)G (ll)CC TAG CTG GtG-3'
#D212_1

III

5'-AAC AGA GTC CAT 6GT-3'
#D214_1

5'-ATG TCC TAG CTG GTG-3'
#D57_1

5'-A(IV)C {IV)GA GTC CAT GGT-3'
#D215_1

5'-A(IV)G (IV)CC TAG CTG GTG-3'
#D216_1

5'-A(V)C (V)GA GTC CAT GGT-y
#D203_1

5*-A(V)G (V)CC TAG CTG GTG-3'
#D204_1

5'-A(VI)C AGA GTC CAT GGT-3'
#D205_1

5'-A(Vl)G TCC TAG CTG GTG-3'
#0206 J

VI ,

5'-A(VI)* AGA GTC CAT GGT-3'
#D207_1

5'A(VI)* TCC TAG CTG GTG-3'
#O208_1

VII

5'-A(VII)C (VII)GA GTC CAT GGT-3'
#D158_3

5'-A(V!l)G (VII)CC TAG CTG GTG-3'
#D101_2

VIII

5'-A(Vlir)C (VIII)GA GTC CAT GGT-3'
#D217_1;2,3

5'-A(VIH)G (VIII)CC TAG CTG GTG-3'
#D218_1

Metal

Complexes

Sequence Containing Wire On G
Surfece and Numbering

5-ACC ATG GAC TCT GT(Uw)-3'
#0201 J,2

S-'ACC ATG GAC TCT GT(Uw)-3'
#D201_1.2

III

5'-ACC ATG GAC TCT GT(Uu»)-3'
#D201_1.2

5'-ACC ATG GAC TCT GT(Uw)-3'
#D201_1,2 ,

5'-ACC ATG GAC TCA GAOU^'
#D83_17,18

5'-ACC ATG GAC TCT GTOk^^'
#D201_1,2

, . . .'

5'-ACC ATG GAC TCT GT(Uw)-3'
#D20i_1.2

VII

5*-ACC ATG GAC TCA GA(lU-3'
#D83J7,18

VIII

ff-ACC ATG GAC TCA GA(U„)-3'
#D83_17.18

Example 9
Preferred Embodiments of the Invention

wo 99/57317 PCT/US99/10104
A variety of systems have been run and shown to work well, as outlined t>etow. All compounds are
referenced in the Figures. Generally, the systems were run as follows. The surfaces were made,
comprising the electrodep the capture prot>e attached via an attachment linker, the conductive
pligomers, and the insulators, as outlined at)ove. The other components of the system, including the
5 target sequences, the capture extender probes, and the lat>el probes, were mixed and generally

annealed at SO^'C for 5 minutes, and allowed to cool fo room temperature for an hour. . The mixtures
were then added to the electrodes, and AC detection was done.

Use of a capture probe, a capture extender probe, an un!at>eled target sequence and a label p rohg;

10 A capture probe D112, comprising a 25 base sequence, was mixed with the Y5 conductive oligomer
and the fMA insulator at a ratto of 2:2:1 using the methods above. A capture extender probe D179,
comprising a 24 base sequence perfectly complementary to the D112 capture probe, and a 24 base
sequence perfectly complementary to the 2tar target, separated by a single base, was added, with the
2tar target The D179 molecule carries a ferrocene (using a CI 5 linkage to the base) at the end that

15 is closest to the electrode. When the attachnient linkers are conductive oligomers, the use of an ETM
at or near this position allows verification that the D179 molecule is present A ferrocene at this
position has a different redox potential than the ETMs used for detection. A label probe D309
(dendrimer) was added, comprising a 18 t>ase sequence perfectly corrtplementary to a portion of the
target sequence, a 1 3 base sequence linker and four fenwenes attached using a branching

20 configuration. A representative scan is shown in Figure 16A. When the 2tar target was not added, a
representative scan is shown in Figure 16B. No further representative scans are shown.

Use of a capture probe and a labeled taro et sequence:

Example A: A capture probe D94 was added with the Y5 and M44 conductive oKgomer at a 2:2:1 ratio
25 vtnth the total thtol concentration being 833 pM on the electrode surfece, as outfined above. A target
sequence (D336) comprising a 15 base sequence perfectly complementary to the 094 capture probe,
a 14 base linker sequence, and 6 ferrocenes linked via the N6 compound was used. A representative
scan is shown in Figure 20C. The use of a diffierent capture probe. D109. that does not have .
honrK>k3gy with the target sequence, served ds tt^^

Example B: A capture probe D94 was added with the Y5 and M44 conductive oligomer at a 2:2:1 ratio
with the total thiol concentration being 833 \iM on the electrode surfece, as outiined above. A target
sequence (D429) comprising a 15 base sequence perfectfy complementary to the D94 capture probe,
a 0131 eSiyfene glycol finker hooked to 6 ferrocenes linked via the N6 compound was used. A
3 5 representative scan is shown in Rgure 20E. The use of a different capture probe, D1 09. that does not
have homotogy with the target sequence, served as Ote negative control.

wo 99/57317

PCT/US99/10104

Use of a caphire probe, a capture extender probe, an untebeted taroet s^uence and two label probes
with long linkenf between the target binding sequence and the ETMsr

The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe
D179 were as outlined above. Two label probes were added: D295 comprising an 18 baise sequence
5 perfectly complementary to a portion of the target sequence, a 15 base sequence linker and six

ferrocenes attached using the N6 linkage depicted in the Figures. D297 is the same, except that if s 18
base sequence hybridizes to a different portion of the target sequence.

Use of a capture probe, a capture extender probe, an unlabeled target sequence and two label prob^^

10 with short linkers between the target binding sequence and the ETMs:

The capture probe D112, Y5 conductive oligomer, the M44 insulator, and capture extender probe
pi79 were as outlined above. Two label probes were added: D296 comprising an 18 base sequence
perfectly complementary to a portion of the target sequence, a 5 k^se sequence tinker and six
ferrocenes attached using the N6 linkage depicted in Figure 23. D298 is the same, except that rfs 18

15 base sequence hybridizes to a different portion of the target sequence.

Use of two capture probes, two capture capture extender probes, an unla beled laroe target sequence

and two label probes with long linkers between the taroet binding sequence and the ETMs:

This test was directed to the detection of rRNA, The Y5 conductive oligomer, the M44 insulator, and

20 one surface probe D350 that was complementary to 2 capture sequences D417 and EU1 were used
as outlined herein. The D350. Y5 and M44 was added iat a 0.5:4.5:1 ratio. Two capture extender
probes were used; D417 ttiat has 16 bases complementary to tiie D350 capture probe and 21 bases
complementary to the target sequence, and EU1 that has 16 bases complementary to ttie D350
capture probe and 23 bases complenrientary to a different portion of ttie target sequence: Two label

25 probes were added: D468 comprising a 30 base sequence perfectly complem^tary to a portion of ttie
target sequence, a linker comprising ttiree glen linkers as shown in Figure 15 (comprising
polyethylene glycol) and six ferrocenes attached using N6. D449 is ttie same, except that it*s 28 base
sequence hybridizes to a different portion of the target sequence, and ttie polyettiylene glycol linker
used (C131) is shorter.

Use of a capture orobe. an unlabeled taroet and a label omba:

Example A: A capture probe D112. YS conductiva <yigomer and tha iMA InftittafAr Wft pi

electrode at 2:2:1 ratio witti ttie total ttitoi concentrattoh bang 833 pM. A target sequence MiTI was
added, ttiat comprises a sequence complementary to D112 and a 20 base sequence complementary
35 to ttie tobel probe D358 were oonribined; In ttiiscase^ ttie label probe D358wiasad^^ .
sequence prior to ttie introduction to ttie electrode. The label probe contains sbc ferrocenes attached
using ttie N6 finkages depicted in ttie Rgures. The replacment of MT1 witti MC112 whfch is not

100

wo 99/57317 PCTAJS99/10104

complementary to the capture prot)e resulted in no signal; similarly, the removal of mi resulted in no
signal.

Scample B; A capture prol)e D334. Y5 conductive oligomer and the M44 insulator were put on the
5 electrode at 2:2:1 ratio with the total thiol concentration being 833 |jM. A target sequence LP280 was
added, that comprises a sequence complementary to the capture probe and a 20 base sequence
complementary to the label probe D335 were combined; in this case, the label probe 0335 was added
to the target prior to introduction to the electrode. The label prc)be contains six ferrpcenes attached
using the N6 linkages depicted in the Figures. Replacing LP280 with the LN280 probe (which is
1 0 complementary to the label probe but not the capture probe) resulted in no signal.

101

WOW57317

PCT/US99/10104

CLAIMS

Wedaim:

1/ A composition comprising an electrode comprising:

a) a monolayer conlprising a mixture of conducth^e oligomers and insulators; and

b) a covalently attached capture binding ligand.

2. A composition according to claim 1 further comprising:

a) a solution binding ligand comprising a first portion that will bind to a target analyte; and

b) a recruitment linker comprising a first portion comprising at least one ETM.

3. A composition according to claim 2 wherein said solution binding ligand comprises a second portion
comprising said recruitment linker.

4. A composition according to claim 2 wherein said solution binding ligand comprises a second
portion that will directV or indirectly bind to a first portion of said recru^^

5. A composition according to claim 4 wherein said second portion of said solution binding ligand will
directly bind said first portion of sakJ recruitment linker.

6. A compositk>n according to claim 1 further comprising:

a) a target analyte analog comprising a recruitment linker comprising a first portfen comprising
at least one ETM.

7. A composition according to daim 1 further comprising:

a) a recruitment linker comprising a first portton comprising at least one ETM; and

b) a target analyte analog comprising a first portion that will directly or indirectly bind to a
second portion of said recruitment linker.

8. A composition according to claim 2. 6 or 7 wherein said ETM is ferrocene.

9. A composition according to claim 2, 6 or 7 wherein said recruitment linker comprises a plurality of
ETMs.

10. A conriposltion according to claim 1 wherein said capture Nndln

1 1. A connposftfon according to claim 1 wherein said capture binding ligand is a proteai.

102

wo 99/57317 PCT/US99/10104
12. A composition according to claim 1 wherein said capture binding ligand Is a cart)Ohydrate.

13. A composrtion according to claim 2, 6 or 7 wherein said recruitment linker is nucleic acid.

14. A method of detecting a target analyte in a sample comprising:

a) binding a target analyte to an electrode coniprlsing:

i) a monolayer comprising a nwxture of conductive oligomers and insulators; and

ii) a covalently attached capture binding ligand;

b) binding a solution binding ligand to said target analyte. wherein said solution binding ligand
comprises a first portion that will bind to a target analyte and a directly or indirectly attached
recruitment linker comprising a first portion comprising at least one ETM; and

d) detecting the presence of said ETM using said electrode as an indication of the presence of
the ta^et analyte.

1 5. A nriethod of detecting a target analyte in a sample comprising:

a) replacing saki target analyte in said sample with a target analyte analog comprising a
directly or indirectly attached recruitment linker comprisinjg a first portfon comprising at least
one ETM;

b) binding said target analyte analog to an electrode corhprising:

i) a monolayer comprising a mixture of conductive oligomers and insulators; and

ii) a covalently attached capture binding ligand;

d) detecting the presence of said ETM using sakI electrode as an indfcation of the presence of
the target analyte.

16. A method according to claim 14 or 15 wfhereln said recruitment linker comprises a plurality of
ETMs.

17. A method according to claim 14 or 15 wherein sakI ETM is ferrocene.

18. A method according to claim 14 or 15 wherein said capture binding ligand is nudefc acid.

19. A method according to claim 14 or 15 wherein said capture binding ligand is a protein.

20. A method according to daim 14 or 15 wherein said capture binding Bgand is a carbohydrate.

21. A method according to claim 14 or 15 wherein said recruitment linker is nucleic add.

103

wo 99/57317

1/35

PCTA;S99/10104

120

■100

■106

/ / /

707

^705

720

wo 99/57317

2/35

PCTAJS99/10104

•loo

iliiiiiJilJlMMt!

re j?^

wo 99/57317

3/35

PCTAJS99/10ia4

-*'135

7r7

I ^ /■ / z'

F/G.

^20

■108

wo 99/57317

4/35

PCr/US99/10104

*-135

FIG.- 3T>

105

FIG.- S£

WOW/57317

5/35

PCTAJS99/10104

wo 99^17

6/35

PCTA}S99/10104

■1-

<6^

wo 99/57317

9/35

PCT/US99/10I(M

WOW/57317

10/35

PCTAJS99/ipi04

— r -

2_r

v.:

O !

■ ! i

n i

i i. ii ^ii UL

*■ if- yi jf.

^-2

y y

FIG. 6X

\\ i i 'i

wo 99/57317

11/35

PCT/US99/lO]a4

W099«7317 PCT/US99/10I04

12/35

wo 99/57317 FC1YUS99/10104

13/35

wo 99/57317 ^4^35 PCr/US99/10]04

DNA

wo 99/57317

15/35

PCTAJS99/ldl04

wo 99/57317

17/35

PCT/US99/10104

Synthesis Scheme of Branched Adenosine

ms N17

18/35

PCTAJS99/10104

Synthesis Scheme of Y63

Y6S

W099«7317

19/35

rCTAJ$99/10104

Syatiieds Scheme of £th:^ene Glycol Tempted Wires

Af^Oj/DMF

(fBn)(Pli)iSi-<OCH2CH296Br

n=2,C120

iF-3,W68
ii=4,W73

iNa

«. (tB^OCPldlSi-toCHiCBa^H
ii-»2,CU9
nF3,W55
IF=4,W72

(<Bu){pi(bSi-feCH2CH2^—^^I

DMP

n»2,C12l
n"3,W69
ff-4,W74

n»2,C12Z
a?^3,W70
W4.W7S

Pd(dba)2/PIVCuI/HN(iE>r)2/DMF

S-feCHiCHi^0--^^--^--^^S--CHi:H^CCH3j,

n»2,H3

n"3,W7l

n»4,W76

wo 99/57317

20/35

PCTAJS99/10104

wo 99/57317 gt/SS PCT/US99/l6l04

Ijst of Metal complexes for Comparison

wo 99/57317

22/35

PCTAJS99/10104

FIG.

wo 99/57317

24/35

PCTAJS99/10104

W699«7317

25/35

PCTAJS$9/10I04

«^ ia;s8

I^^M • DMTov ^ J? ^ ^

i5p

wo 99/57317

26/35

PCr/US99/10104

wo 99/57317

28/35

PCTAJS99/10104

Synthesis Scheme of Cytidine Ferrocene

FIG. /f-

wo 99/57317

29/35

PCTA;S99/10104

■■II ' ' .-. ]i ■

SC^^CHa-ji— SCHjCHj-|i—
5VAtiacIiaieiit Any Positton Attachment

FIG. VSA

FIG. /Z3

wo 99/57317

30/35

PCT/US99n0104

StaixidardDNA SyoOtesis U»Dgl^7

-T-^NlT-r-C G — griT-

- 0-1

t NlT C T— -Nl7

") >

( OCHiCHjCN (

DMTofT
— C— G ^NIT— G T-

-Suppoit

O (>

9CH2CH2CN

OCHjCHiCN

o o

0 0 - ^-

O OCHCTiP*

Tbis process call be repeated untQ the desired # of Ferrocene

is obtained, and then Iiydro^ groups on ferrocene are capped

using the left phospboramidite in order to increase tlie solubility
lXMT«dr/ClevaseadDeprotectio.| ^y^^^^^^

5* o,

o o

o* o

^^--^^ ^^-^

OPOj"

W099«7317 31/35 PCTAJWMOHM

Scheme of Incdiporatfng Moltlpile ETMs Using Branching Phosphoranoidite

Standard DNA. Sjn^iesis

-A-T-

ConpBBEto
DMT off

CI^OCI^ai^B^tlDMT

CI^OC^CHiCH^DMT

CHtaOCHiCHiC^CK

OCHiCHaPI /

5, 1 — 0-|-0CHa-C;^C%pCH2C^|q^iaa

CS^OCS^CHxCHjpH

This covpUng process can be repeated until ooptv^ y»aOa%a^TOPK
desired # of tlic brancUng points l-ocii*-c^cBaqa%

J, gi O-|-0Clli~^<Ha0C!ta^iCH20—

SnppDit CH,OCBiCH,a%p

Finally, ETMs are Introduced ^^4^^"^
Cleavage and Deprotectlon » ^cB(,oci%cwftOH

i—T—G-C i

ySjiQCB^aCS^O-siM
^••oeqi*cwC^OCI%O^CS^C>--6nyi
/* OliOCaaCHaC^O-EiM

, C^jOCTaCBbCHiD-STM
pc«r-«:%0C%C^CH2O-™

wo 99/57317

32/35

PCT/US99/10104

<222j22^22S5j = RRST HYBRIDIZABLE PORTION OF LABEL PROBE
= RECRUITMENT LINKER

(ETM)n (ETM)n

I J ^(ETM)n

(NUCLHCACID)

^^^^^^z^^^^Z^^^J^^^N/v/A/NyB/v/C/s/D/syEyN/^/NFv/v/v/V/

• > ;> ^

ETM ETM ETM METALLOCENE
(METALLOCENE)n

A = NUCLEOSIDE REPLACEMENT E = METALLOCENE POLYMER, ATTACHED

8= ATTACHMENTTOABASE TO A RIBOSE, PHOSPHATE. OR BASE

C = ATTACHEMENTTOARIBOSE F = DENDRIMER STRUCTURE, ATTACHED

D»ATTACHMENTTOAPHOSPHATE VIAA RIBOSE, PHOSPHATE OR BASE

— -V ^ '

(NUCLeCACID)

G » ATTACHMENT VIA A"BRANCHING
STRUCTURE-, THROUGH RIBOSE,
BwETM PHOSPHATE OR BASE

C'w ETM
D'sA/" ETM

E'NA^ (METALLOCEN^n
> / ^-(ETM)„
'> ^(ETM)„

^ . ^ _ '

wo 99/57317

33/35

PCT/U599/10104

= c

OPTIONAL
CROSS UNKUP

(NUCLEIC ACID)
^B/\yC/\/D/

ETM ETM ETM (METALLOCENE)^

(MErALLOCENE)n
H 1-

/ETM

J— (NON-NUCLBO
ACID)

I 1

H = ATTACHMENT.OF METALLOCENE POLYMERS
1= ATTACHMENT VIA DENDRIMER STRUCTURE
J « ATTACHMENT USING STANDARD UNKERS

H'N/v (METALLOCEN^
/-(ETM)„

>^(ETM)„

^(ETM)n
J ~ ETM

wo 99/57317

34/35

PCT/US99/10104

DI79

5*-A{C15)CCIXXncrTGAaTCX:ACXKiAA<KKXnGOAAATAO^^
D309(Dendiima)

5' - (W38XBraBclung){Bianchmg)CATC^
D295

5' - (N6)G(N6)CTT(N6)CXN6)(HN6)C(N^^
D297

5\.(N(9G(N6)CT(N6)C(N6)G(N6)C(N6)TATXKnXTrGATXX^^
D298

5'-(N6)G(N6)CnXN6)0(NQ(i(NQqN6)ATXK^^
D296

5' - (N6)G(NQCIlCNQC(N6)G(N6)qN6)TCACTX5M
D112

5* - (TrCCGTGGAT(nCAAGA0CAGGAU>4 unit wm
D94

5'-ACCATGGACACAGAU-4unitwire(CIl)-3'
D109

5' - OXXXKOTATTAAOJ- 4 unit wire (CI 1)- 3*
2Tar

5* -TAG GCA CGA ATA CGT ATTTCC ACG ATA AAT ATA ATT AATAACCGC AGC AATTCA

CGT ATA AAG CTATCCCAG TAG ATTTTC ACA GC-y

D349

5^A(CI5)C (d5)GTGTCCAT GGT AGT AGCTTA TCG TGG AAA TACGTA TTC GTC
D382

TATTAA-3 . .

D383

TACTCG-3
D468

AAuTAC-3

wo 99/57317

35/35

PCT/US99/10104

D449
D417

5'-(nTTACTCCCrrCCTO0CCGCTGAAAGTACTTTACAA<XC-3*
EUl

5 • - ATC CTC GTC TTC ACA TCC ACG GAA GAT GTC OCT ACA GTC TCC ATC AGG CAG TTT
CCCAGACA-3'

MTl

5'-TCr ACA TGC on" ACA TAG GGAACOTACGGAGCA TCCTGG TCT TGA CATCX:ACGG
AAG-3'

D358

5*-(N6)G(NOCI1(NQC(NQG(NQqNQC(»TATGTA
D334

5*-GCTACTACCATGGACACAGAU-4«miWBt(CIl)-3'
D335

5'-ACAGACATCAGAGTAATC(N6)GCCa«]GTC(N6)TCG(N6)T-3V
LP280

5'-GATTACTCTGATGTCTGTCCATCTGTG TCC ATG GTA GTA GC-3*
LN280

5'-GATTACTCTGATGTCTGTCCrAGTACGAGTCAGTCTCTCCA-3'
NCI 12 ' ■

5'-TCTA(:aTGCCGT ACA TACGGA Aa3TACGGAGCGATrCGACre ACA GTCGTAACC
0336 ■ ■ ' '

5'-(N6)G(N6)CT(N6)C(N6)G(NTOIQGCOACAACTGTACCATCTGTCTCCATGGT-.3'
D405

5'-(C23XC23XC23)(C23XC23XC23)(C23XC23XC23)(C23)ATCroTCTa:ATCGT-3'
D429

5'-(N6)G(NQCT(N(5)0(N6)G(N(9C(NQ(C131)ATCTGTCTCaTGGTAGTAGC-y

INTERNATIONAL SEARCH REPORT

tnterr nal AppOcotlon No

PCT/US 99/10104

a. RELOSSEARCHEO

Minimum documentation seaichod

IPC 6 C12Q GOIN

(ctassneatlon ayatem foflowed by classification symlyob)

Documentation searctied other than

minimum documentation to the extern that such documents am IndixM

A. (XASS>FICATK)H OF .SUBJECT MATTER

IPC 6 C12Q1/68 601N27/30

Accoiding to WenwliorolPatertqagsifleallonqt^ or to boft national

Etadnnle data baMcomullad during tha tntamatlonal search (nama of data base and. wtwrs practical, aaaroh terms used)

C. DOCUMENTS CONSIDEREO TO BE RELEVAITT

Calsgory • CItatton o( document, wit»> Indication, wtwre ajjproprlato, ot the relevant passages

Relevant to daim Mo.

UTO Y ET AL: "Electrochemical analysis of
DNA amplified by the polymerase chain
reaction with a f errocenyl ated
oligonucleotide"
ANALYTICAL BIOCHEHISTRY,
vol. 250, no. 250, 1997, pages 122-124
124, XP002106964
ISSN: 0003-2697

WO 86 05815 A (GENETICS INT INC)
9 October 1986 (1986-10-09)
the whole document

WO 96 40712 A (CALIFORNIA INST OF TECHN)
19 December 1996 (1996-12-19)
the whole document

-/-

1-21

Further documents are Istad In the oonthuation d box C.

Patent family membere are Isied In annex.

* Spedal categories of dted documents :

"A* document defining the general state of the art which is not

consMeied to be of particular relewanoe
^* earttor document but published en or after the Intel na tl oi iu i

filng date

T* document which may ttvow doubts on prtordy clabn(s) or
which to ci ted to estabnsh the pUbflcatton date of another
ci t a ti on cf otfier sp e ci al reason (as a p e cl Bo d)

'O" document ref arrtng to an oral dtodoeure^ uss^ eoMHttonor
dtwr means

"P* document published prkir to the Mematlqnal flingdatebul
later tftan the priority date darned

T" later document pulilished after the International fQhg date
or priority date and not In confBct with the applcationbut
cSed to understand the princ^ or theory undertytngthe •
frrvenHon

"X* document of particular relevance; the claimed Invention
cannot be considered novel or cannot be considered lo
Involve an bwenttve step when ttie document is taker) atone

"Y* doomrt of particular mlevimoe; the claimed inve ntion
cannot be oonsldeied to Involve an ifwenttve step when ttie
document Is ooRibkiedvAh one or more other suchdocu-
ments^ such combkiatlon being obvious lo a personskBetf
Intheart.

'V document member of the eante patent family

Date of ttie actu al oompletion of the fintematfonal search

13 October 1999

Dale of mating ot the interrKttional eeaich report

19/10/1999

Mame and maling address of the ISA

European PAertt Offloe. P.a 5018 Patendaan 2
rC>2280HVR|Bwipc
Tel. (451-70) 340-5040, TX. 31 651 epo nl.
Fax: (+31-70) 340-3016

Roan PCnSAaiO (seodnd riiMO (Jiiy 1882)

Hailer, F

page 1 of 2

INTERNAtlONAL SEARCH REPORT

a<CoiiUhuation) DOCUMENTS CONSIDERED TO BE REtEVAMT

Intern '^al Application No

PCT/US 99/10104

Category * Citation oT document with {ndicaxion,wtiem appropriate. Of the reievant paesagea

Relevant to ctabn No.

P.x

p.x

wo 93 22678 A (BAYLOR COLLEGE MEDICINE
; HOUSTON ADVANCED RES CENTER (US);
MASSACH) 11 November 1993 (1993-11-11)
see whole doc. esp. claims (e.g. 42)

WO 98 57159 A (CLINICAL MICRO SENSORS INC)
17 December 1998 (1998-12-17)
the whole document

WO 98 20162 A (GOZIN MICHAEL ;YU CHANGJUN
(US); KAYYEM OON F (US); CLINICAL MICRO)
14 May 1998 (1998-05-14)
cited In the application
see whole doc. esp. claims

1-21

nm PCT/ISMnO(cenlnurtan al MieM dMO (My IMS)

page 2 of

INTERNATIONAL SEARCH REPORT

dmwlioii on patent tamOy member*

Intern ' pal AppUcatton No

PCT/US 99/10104

patent document
cHed in search report

PubScaiion
dato

Patsnttamay
membei(s)

PubDcation
data

WO 8605815

09-10-1986

AU
EP

5667186 A
0216844 A

23-10-1986
08-04-1987

WO 9640712

19-12-1996

US
AU

EP
US

5824473 A
6166296 A
0871642 A
5770369 A

20- 10-1998
30-12-1996

21- 10-1998
23-06-1998

WO 9322678

11-11-

-1993

5846708 A

08-12-1998

0638173 A

15-02-1995

7508831 T

28-09-1995

5653939 A

05-08-1997

WO 9857159

17-12-

-1998

7967898 A

30-12-1998

WO 9820162

14-05-

-1998

5196798 A

29-05-1998

EP .

0939762 A

08-09-1999

Fbm>PCT7l9AglO tti«to<iMia y wiM) pJy19B2>

TfflS PAGE BLANK (MSPTO)

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Books

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "USPTO Patents Application 10687850"

See other formats